Table extent of Sexually Dimorphic Expression of pr in Various Brain Regions in prpl



Download 60.45 Kb.
Date conversion15.05.2018
Size60.45 Kb.
Table S1. Extent of Sexually Dimorphic Expression of PR in Various Brain Regions in PRPL Mice, Related to Figure 2

Similar location of PR-expressing neurons in PRPL/PL mice. Mean ± SEM; n = 3/sex. AP = anteroposterior, DV = dorsoventral, ML = mediolateral, ND, not detected. All coordinates relative to bregma here and in Table S2 (Paxinos and Franklin, 2003).




Female

Basal Forebrain

AVPV/POA

BNSTmpm

VMHvl

Arcuate

MeApd

AP

ND

0.350.03

to


-0.340.00

0.240.02

to

-0.220.00



-1.340.07 to

-1.96.07



-1.340.00 to

-2.510.03



-1.750.17 to

-2.220.04



DV

ND

-5.160.08

to


-5.770.02

-3.980.13

to


-4.580.08

-5.430.09 to

-5.830.07



-5.420.08 to

-5.970.03



-4.520.16 to

-5±0.12


ML

ND

00.00

to


0.650.08

0.470.02

to


0.920.22

0.570.07

to


10.00

00.00

to


0.530.09

1.870.08

to


2.080.17

Male

Basal Forebrain

AVPV/POA

BNSTmpm

VMHvl

Arcuate

MeApd

AP

1.430.06

to


0.540.08

0.340.04

to


-0.380.04

0.340.04

to


-0.30.04

-1.380.04 to

-1.940.00



-1.340.07 to

-2.060.31



-1.620.04 to

-2.350.05



DV

-5.50.14

to


-5.70.10

-4.950.10

to


-5.830.08

-3.80.17

to


-4.920.08

-5.180.04 to

-5.780.02



-5.440.06 to

-5.930.07



-4.60.15

to


-5.130.12

ML

0.50.25

to


1.420.30

00.00

to


0.580.08

0.430.03

to


1.080.08

0.50.06

to


10.00

00.00

to


0.580.08

1.920.08

to


2.420.08


Table S2. Extent of PR+ VMHvl Projections to Different Brain Regions in PRCre Mice, Related to Figure 3

Similar regional localization of projections of PR+ VMHvl neurons in PRCre mice injected with Lenti-lxlplap. Mean ± SEM; n = 3/sex.




Female

AVPV

POA

PAG

AP

0.350.03 to

-0.180.04



0.180.04 to

-0.220.07



-2.790.13 to

-5.000.02



DV

-4.920.08 to

-5.820.04



-4.850.08 to

-5.750.00



-1.920.08 to

-3.170.08



ML

0.000.00 to

0.180.04



0.280.02 to 0.830.08

0.250.00 to 1.000.00

Male

AVPV

POA

PAG

AP

0.380.07 to

-0.180.04



0.140.00 to

-0.340.00



-2.770.03 to

-5.080.06



DV

-5.080.08 to

-5.870.03



-4.920.08 to

-5.750.00



-2.00.00 to

-3.080.08



ML

0.000.00 to 0.200.05

0.260.02 to 0.830.08

0.250.00 to 1.000.00



Table S3. List of PCR Primers, Related to Figures 1, 3, 5


Primer description

Primer sequence (5’ – 3’)

ISH probe, Cckar, forward

CAGGTTGCATTTGGGAGACT

ISH probe, Cckar, reverse

ATGAGTCCGTAAGCCACCAC

ISH probe, Cre, forward

CCAAGAAGAAGAGGAAGGTGTC

ISH probe, Cre, reverse

ATCCCCAGAAATGCCAGATTAC

ISH probe, PR, forward

CACAGTATGGCTTTGATTCC

ISH probe, PR, reverse

TTTGTGAGTTGGTAGAAGCGC

F1

GGTGTCATCTGTGGCCTCTGGAAGCAG

F2

CTACAGTCAAGAGCAACTGATGG

F3

GACCGCTTCCTCGTGCTTTACGGTATCG

R1

GGCGGAATTCGGCGCGCCTCATCAC

R2

CTACCAGATCCAGTGGGCGGGGAAAG

qPCR, PR, forward

TGTCCGGGATTGGATGAAT

qPCR, PR, reverse

GCTTGCATGATCTTGTGAAACA

qPCR, Rpl32, forward

CGGTTATGGGAGCAACAAGAAAAC

qPCR, Rpl32, reverse

GGACACATTGTGAGCAATCTCAGC







The database is protected by copyright ©dentisty.org 2016
send message

    Main page