Supplementary Table co-foldings of tracrrna and crispr repeats associated with the examined type II crispr-cas systems



Download 39.79 Kb.
Date09.12.2016
Size39.79 Kb.
Supplementary Table S5. Co-foldings of tracrRNA and CRISPR repeats associated with the examined type II CRISPR-Cas systems.

strain

Cas9 tree position a

CRISPR repeat-loop-tracrRNA sequence and predicted secondary structure b

Francisella novicida U112

1

GUUUCAGUUGCUGAAUUAUUUGGUAAACUACUGUUAGNNNNNNAUCUAAAAUUAUAAAUGUACCAAAUAAUUAAUGCUCUGUAAUCAUUUAAAAGUAUUUUGAACGGACCUCUGUUUGACACGUCUGAAUAAC

(((.(((..((..(((((((((((.........((((........))))............)))))))))))...)).))).)))...............(...(((((...(((...))).)))))...)..

gamma proteobacterium HTCC5015

2

GUUUCAGCUGUUGGUUUGUUGGGAUAAGCUCUGAAACNNNNNNUCAGAAUGCAUCCCAACAUUCUAUACACUGAAAUCAUAGAAAAUCACGUUUGUGGCCCGACCAACUGCUUCGGCAUGUCGGGUUUUUU

(((((((..((.....(((((((((..(.(((((.........))))).)..)))))))))......)).)))))))...................((((((((....(((....))).))))))))....

Parasutterella excrementihominis YIT11859

3

GUUUCAGUAGUUGUUAGAAGAAUGUAGUAUUGAAGCCNNNNNNUUAAUUACAUUCUUUUAACAACGAAGUCGCCUUCGGGCGAGCUGAAAUCAAUUUGAUUAAAUAUUAGAUCCGGCUACUGAGGUCUUUGACCUUAUCCGGAUUAACGAAGAGCCUCCGAGGAGGCUUUUU

((((((((.(((((((((((((((((((..................)))))))))))))))))))....(((((....)))))))))))))..................(((((((.....(((((.....)))))..)))))))....(((((((((....))))))))).

Sutterella wadsworthensis 3_1_45B

4

GUUUCAGUGCUAUAGCUCGUAGCGUUAUGAUCUUCGCNNNNNNUUAGAGAUCAUAACGCUAUGAGCUAUAGGAAAUCACCUUCGGGUGAGCUGAAAUCCCCUAAAGCUAAGAUUGAAUCCGGCCACUAUCUAUUAGUAGAUAUCCGGAUAUUCU

((((((((.(((((((((((((((((((((((((............)))))))))))))))))))))))))....(((((....))))))))))))).................((((((((....((((((....)))))).))))..)))).

Legionella pneumophila str. Paris

5

GUUUCAGUGGUUGGAUUUUUAGAUGAGGGAUUAUUGGNNNNNNUAAAUUAGAAAUCAUCUAAAUUUCGAUACCCUGAAAUCAACAAAAUUAAAGAUUGAAUCGUUUUUCUAUGCUCGUCUUAAUAGCGAGCAUAUAACGAUUU

(((((((.((((.((..(((((((((......(((..........)))......)))))))))..)).).))))))))))..................(((((((....(((((((((.......))))))))).))))))).

Wolinella succinogenes DSM 1740

6

GUUUCACAGGCUAAGCGGAUUUGCUAUAAAGUGUUGCNNNNNNUUGUUAGAAUGUUCCCGCAACACUUUAUAGCAAAUCCGUUCGAUGCCUUGAAAUCAUCAAAAAGAUAUAAUAGACCCGCCCACUGUAUUGUACAUGGCGGGACUUUUU

((((((.((((..((((((((((((((((((((((((........(............)))))))))))))))))))))))))....)))))))))).....(((((..........((((((...(((.....))).)))))).))))).

Staphylococcus pseudintermedius ED99

7

GUUUUAGCACUAUGUUUAUUUAGAAAGAGGUAAAACNNNNNNGUUUUACUUCUUUCUAAAUAAACAUAGUUAAGUUAAAACAAGCUUAAAGCGUCAAUGUAAUAUUUUAUUAACACCCUACUGUGUCAGUGGGGUUUUUUU

((((((((..((((((((((((((((((((((((((......)))))))))))))))))))))))))).....))))))))(.(((...))).)..............(.....(((((((((...)))))))))....).

Planococcus antarcticus DSM 14505

8

GUUUUAGACCAAUGUAAUUUUAGAGAGUAGUAAAACNNNNNNAUUUCAAAAUAUUCCCCCUUUACAUUUUUCAAAAGAAAAUGUACGCUAAGAGUGUUACUACUCUGUAACAUUACAUUGGUACGUUAAAAUAAGCUUAAAGCGUAAAAGUUGGCCCUAUGAGGUCUCC

((((((.(((((((((((.(((.((((((((((.............................((((((.(((....)))))))))(((.....))))))))))))).))).)))))))))))....)))))).(((((.........)))))((((......))))...

GCCAUCGACUUCGUCGGUGGCUUUUUU

((((((((.....))))))))......

Streptococcus sanguinis SK49

9

GUUUUAGAGCUGUGUUGUUUCGAAUGGUUCCAAAACNNNNNNAACUACGUUGGAACUAUUCGAAACAACACAGCCAAAAGAUUUUUCUUUUGAGUUAAAAUAUGGUUAUCCAUAAUCAGUUAUGCGCACCGAUUCGGUGCUUUUUU

......(.(((((((((((((((((((((((((................))))))))))))))))))))))))))((((((....))))))..((.....(((((....))))).........))((((((...))))))......

Listeria innocua Clip11262

10

GUUUUAGAGCUAUGUUAUUUUGAAUGCUAACAAAACNNNNNNAUUGUUAGUAUUCAAAAUAACAUAGCAAGUUAAAAUAAGGCUUUGUCCGUUAUCAACUUUUAAUUAAGUAGCGCUGUUUCGGCGCUUUUU

((((((..(((((((((((((((((((((((((..........)))))))))))))))))))))))))....))))))..(((...).)).......((((......))))((((((.....))))))....

Streptococcus pyogenes SF370 (M1 GAS)

10

GUUUUAGAGCUAUGCUGUUUUGAAUGGUCCCAAAACNNNNNNGUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU

((((((..((((((((((((((((((((.((((..........)))).))))))))))))))))))))....))))))..(((..).)).......((((....))))((((((.....))))))......

Streptococcus thermophilus LMD-9

11

GUUUUAGAGCUGUGUUGUUUCGAAUGGUUCCAAAACNNNNNNUUGUGGUUUGAAACCAUUCGAAACAACACAGCGAGUUAAAAUAAGGCUUAGUCCGUACUCAACUUGAAAAGGUGGCACCGAUUCGGUGUUUUUUUU

((((((..(((((((((((((((((((((.((((..............)))).)))))))))))))))))))))....))))))..(((...).)).......((((....))))(((((((...)))))))......

Streptococcus mutans UA159

12

GUUUUAGAGCUGUGUUGUUUCGAAUGGUUCCAAAACNNNNNNGUUGGAAUCAUUCGAAACAACACAGCAAGUUAAAAUAAGGCAGUGAUUUUUAAUCCAGUCCGUACACAACUUGAAAAAGUGCGCACCGAUUCGGUGCUUUUU

((((((..(((((((((((((((((((((((((..........)))))))))))))))))))))))))....))))))(((((...).))))..........(((((.............)))))(((((...)))))......

Coriobacterium glomerans PW2

13

GUUUUGGAGCAGUGUCGUUCUGACUGGUAAUCCAACNNNNNNCGUCUUGAUUACCAGUCAGGACAGCACUGCGAGUCAAAAUACGGCUUUGCCAAACUUGCCUCCCUUCGGAGGCGUCUCGUAGGAGACAAUUUGAAGCCCCUUUAGGGGCUUCAUUUUUCU

((((((..(((((((.((((((((((((((((.(............).)))))))))))))))).)))))))....))))))..(((...)))......((((((....))))))(((((....))))).....((((((((....))))))))........

Lactobacillus farciminis KCTC 3681

14

GUUUUUGUACCUUAAAGAAUCUAGAAAUAGUAAAACNNNNNNGUUUUACUAUUUCUAGAUUCUUUAAGAUCUACAAAAAUAAGGAUUUAUUCCGAAUUUACCACCUAUUUUAAUUAAUAGGUGGUUUUUUU

(((((((((.((((((((((((((((((((((((((......))))))))))))))))))))))))))...)))))))))..(((.....)))......(((((((((........)))))))))......

Lactobacillus rhamnosus GG

16

GUCUCAGGUAGAUGUCAGAUCAAUCAGUUCAAGAGCNNNNNNUGUUGAGACGACAUCCUCAACAACUUGAAUUGAUUGAUCUGACAUCUACGAGUUGAGAUCAAACAAAGCUUCAGCUGAGUUUCAAUUUCUGAGCCCAUGUUGGGCCAUACAUAU

..(((((((((((((((((((((((((((((((..........((((((........))))))..))))))))))))))))))))))))))(((((............)))))...))))).............(((((...))))).........

GCCACCCGAGUGCAAAUCGGGUGGCUUUUUUU

(((((((((.......))))))))).......

Bifidobacterium bifidum S17

17

GUUUCAGAUGCCUGUCAGAUCAAUGACUUUGACCACNNNNNNGGAUUGUUUGGUCGCAAUCCAUGAUCAAGGUCAUUGACCUGACAGGCAUAAAUUGAAAUAAAGCAAGGUUUCGACCAAGCUUCAGAAGGUUUUAUACCUGGCCUUAUGGCUGU

((((..(.((((((((((.(((((((((((((.(......(.(((((((......))))))).)).))))))))))))).)))))))))))......))))..(((..(((....)))..)))(((.((((((........)))))).)))....

GAGGCUCCCGAUAAUGUCGGGAGCCUCUUUU

(((((((((((.....)))))))))))....

Oenococcus kitaharae DSM 17330

18

GCUUCAGAUGUGUGUCAGAUCAAUGAGGUAGAACCCNNNNNNUUGGGAUUGAUCAUCCCAAACAUCAUUGGGUUCUACCUCAUUGAUCUGACACACAGCAUUGAAGUAAAGCAAGAUUAAUUUCAAGCUUAAUUUUCUUCACAUUUUAUGUGCAGAAGG

((((..(.((((((((((((((((((((((((((((((....(((((((.....)))))))......)))))))))))))))))))))))))))))).)....))))..(((..((......))..)))...((((((.(((((...))))).))))))

GCUUAUGCCCACAAUACAUAAAAAGUCCGCAUUCACUUGCGGACUUUUAU

....................(((((((((((......)))))))))))..

Fructobacillus fructosus KCTC 3544

19

GCUUUAGAUGUAUGUCGGAUUAAUGGGGUUUCUUCCNNNNNNCAUGGUUAGCUACCAUACAAGCAAGAAUUGUUUAGCUAACUAUUCUUGCUAGGAAGAACCCAUUAAUCUGACAUACAGGGUUAAAGUAACGCAAGGGCUUCAGCCCAAGCUUCAUG

(((((...(((((((((((((((((((....(((((.......(((((.....)))))....((((((((.((.......)).))))))))..)))))..))))))))))))))))))).....))))).(.((..((((....))))..))).....

AACUUUUAAAAAGUUGGCCUUAUGGCCUUUUUU

((((((...))))))((((....))))......

Finegoldia magna ATCC 29328

20

GUUUGAGAAUGAUGUAAUUUCAUAUAGGUAUUAAACNNNNNNUAAUCUCAGUUUAAUACCUAUAUGAGAUUACAUCAUGAGUUCAAAUAAAAGUUUACUCAAAUCGCCCGAAAGAGCCCACAUUGGUGGACUAAACAAAUCUUCGGAUUUGUUUUUUU

........((((((((((((((((((((((((((((..............))))))))))))))))))))))))))))((((..(........)..))))..............((.((((....)))).))(((((((((....)))))))))....

Veillonella atypica ACS-134-V-Col7a

21

GUUUGCGAGUAGUGUAAUUCUGUAAAUCUCUAAAACNNNNNNAUAAGUAAUCCAAUUAGUUUUGGAGGUUUACAGAAUUACACUACGAGUUCAAAUACAAAUUUAUUUACAAUGCCUUCGGGCCACCCGACGUAGGGUAUCAUCUCAAUUCUUCUGAAUUGGGAUUUUUUU

........((((((((((((((((((((((((((((......................))))))))))))))))))))))))))))...........................(((....))).((((......))))...((((((((((....))))))))))......

Solobacterium moorei F0204

22

GUUUGAGAACUAUGUAAAUUAUGCUGGUAGCAAAACNNNNNNGAAAUUGUCUUAUACCAGUAAGAUAAUUUACAUAGUAAGUUCAAACAAGCUUUUAGCGAAAUUACCGCUUUGCGGAUUCACAUUGUGUGAAGUUAACUCUCGAAAGAGAGUUUUUUCUUU

((((((...(((((((((((((.((((((.(((.............))).....))))))....))))))))))))).....))))))........((((.......)))).......((((((...))))))...(((((((....)))))))........

Eubacterium yurii subsp. margaretiae ATCC 43715

24

GUUUGAGAACCUUGUAAAUCAAUAAGUAUGUAAAACNNNNNNAUAUCAUUAUCAUUGAUUUACAAGGUGAGUUCAAACAAGGAUUUAUCCGUAAUUGAUUGCUCGCAUUGUGCGACAUUUUCUUAUGUAAAUCGUGAAGUCGGACUUUCGACUUCUUUUUUUU

(((((((.(((((((((((((((....(((..(..........)..)))....)))))))))))))))...)))))))(.(((....))).)....((....(((((...))))).....)).............(((((((......)))))))........

Filifactor alocis ATCC 35896

27

GUUUGAGAGUAGUGUAAUUUCAUAUGGUAGUCAAACNNNNNNGUUGACUACCAUAUGAGAUUACACUACACGGUUCAAAUAAAGAAUUUUUCUAAUCGCCCAAUGGGCCCAUAUUGAUAUGGAUGAAACUCGCUUAGCGAGUUUUUUU

(((((((.((((((((((((((((((((((((((.........)))))))))))))))))))))))))).)...))))))(((..............((((...))))(((((....)))))...((((((((...))))))))))).

Treponema denticola ATCC 35405

29

GUUUGAGAGUUGUGUAAUUUAAGAUGGAUCUCAAACNNNNNNAUUUAAGAUCCAUCUUAAAUUACACAACGAGUUCAAAUAAGAAUUCAUCAAAAUCGUCCCUUUUGGGACCGCUCAUUGUGGAGCAUCAAGGCUUAACAUGGUUAAGCCUUUUUUU

...((((.(((((((((((((((((((((((.(((........))).)))))))))))))))))))))))...))))....................(((((....))))).......((........))(((((((((...)))))))))......

Staphylococcus lugdunensis M23590

30

GUUUUAGUACUCUGUAAUUUUAGGUAUAAGUGAUACNNNNNNGUACUUAUACCUAAAAUUACAGAAUCUACUGAAACAAGACAAUAUGUCGUGUUUAUCCCAUCAAUUUAUUGGUGGGAUUUUUUU

(((((((((.((((((((((((((((((((...(.......)...))))))))))))))))))))...)))))))))..((((...))))......((((((((((....))))))))))......

Eubacterium dolichum DSM 3991

31

GUUUUGUUACCAUAUGGAUUUUUGCUAGAUUAAGACNNNNNNUGAUCAUAAUCUAGCAAAAGUUUAUAUGAUCUAACAAAACAAGGGUUUAUCCCGGAAUCAAGUUCCAAGUAUAUGCUUGGAGCUUUUUCUUU

(((((((((.((((((((((((((((((((((.((..........)).))))))))))))))))))))))...)))))))))..(((.....)))((.(..(((((((((((....)))))))))))..).)).

Streptococcus thermophilus LMD-9

32

GUUUUUGUACUCUCAAGAUUUAAGUAACUGUACAACNNNNNNUGUAAGGGACGCCUUACACAGUUACUUAAAUCUUGCAGAAGCUACAAAGAUAAGGCUUCAUGCCGAAAUCAACACCCUGUCAUUUUAUGGCAGGGUGUUUUCGUUAUUU

(((((((((.((((((((((((((((((((............(((((((....)))))))))))))))))))))))).)))...)))))))))..(((.....)))......(((((((((((((...)))))))))))))..........

Enterococcus faecalis TX0012

33

GUUUUUGUACUCUCAAUAAUUUCUUAUCAGUAAAACNNNNNNUGUAGUCGACGGACUACCGUGUUUGACGAAACACGUCUUUAAUAAUUUUACUGAUAAGAAAUUAUUGAGAAUCUACAAAAAUAAGGCAUCUUGCCGAAUUUACCGCCCUACAUAUGUAGGGCGGUUUUU

(((((((((.(((((((((((((((((((((((((........((((((....))))))((((((......))))))..........)))))))))))))))))))))))))...)))))))))..((((...))))......((((((((((....))))))))))....

Eubacterium rectale ATCC 33656

34

AUUUUAGUAACUGAAUAAUUUACGUGACUGUAAAACNNNNNNUGUAGAGAAAAUUUUAUAGUCACGUAAAUUUUUCAGAUCUACUAAAACAAGGCUUUAUGCCGAAAUCAGGAGCACCGACGGGUGCUCCUUUUUUU

(((((((((.(((((.((((((((((((((((((....................)))))))))))))))))).)))))...))))))))...(((.....))).......((((((((....))))))))..)....

Mycoplasma mobile 163K

35

GUUUUGGUGUAGUAUCAUUCUUAUGUAUUCUUAAACNNNNNNUGUAUUUCGAAAUACAGAUGUACAGUUAAGAAUACAUAAGAAUGAUACAUCACUAAAAAAAGGCUUUAUGCCGUAACUACUACUUAUUUUCAAAAUAAGUAGUUUUUUUU

.....((((..(((((((((((((((((((((((........((((((....)))))).........)))))))))))))))))))))))..)))).......(((.....))).......(((((((((.....)))))))))........

Mycoplasma ovipneumoniae SC01

36

GUUUUUGUGCUGUACAAUUUCUUACUAGAGUAAAACNNNNNNCUAGUAAGAAAUUGUCGCACAAAAAUAAGACGCAUUAUGCUGUCGAAUUUCCCCACCUAGUGGGGUUUUUUU

((((((((((.(.(((((((((((((((..............))))))))))))))))))))))))))..((((((...))).)))......((((((...)))))).......

Mycoplasma gallisepticum str. F

37

GUUUUAGCACUGUACAAUACUUGUGUAAGCAAUAACNNNNNNAUUAUUGCUUACACAAUUAUUGUCGUGCUAAAAUAAGGCGCUGUUAAUGCAGCUGCCGCAUCCGCCAGAGCAUUUAUGCUCUGGCUUUUUUU

((((((((((.(.((((((.(((((((((((((((........))))))))))))))).)))))))))))))))))..((((((((....))))).)))......(((((((((....))))))))).......

Mycoplasma synoviae 53

38

GUUUUGGGGUUGUACAAUUAUUUUGUUAAGUAAAACNNNNNNUAUAUAUUACUUACUUAACAAAAUAAUUGUACGAUUCCAAAAUAAGGCGCUUAUGUAAGAUGCAAUAAUGCACUUAUAUAAGCUGCCGUAAACGCCGAGGUAACUCGGUUUUUUU

(((((((((((((((((((((((((((((((((...................)))))))))))))))))))))))))))))))))..((((((((((((((.((((....))))))))))))))).)))....(.((((((....)))))).)....

Mycoplasma canis PG 14

39

GUUUUAGUGUUGUACAAUAUUUGGGUAAACAAUAACNNNNNNAGUACAAAUUAAUUAUUGUUUACCCAAAUAUUGUACAUCCUAAAUCAAGGCGCUUAAUUGCUGCCGUAAUUGCUGAAAGCGUAGCUUUCAGUUUUUUU

..(((((.(.(((((((((((((((((((((((((...................))))))))))))))))))))))))).))))))....((((......)))).....((..(((((((((...)))))))))..))..

Wolinella succinogenes DSM 1740

40

GUUAUAGCCGCCUACUCAGCCAUUCCUCGCUAUAAUNNNNNNCGUCGUCGCUGCGCGAAAUGGCUGAGUAGGCAGCGGCUAUAAUAAGGGGUGUGGAGGCAUCCUGCGAAGUUCUACUCUACGGAGUAUCUUCU

((((((((((((((((((((((((.(.(((......................))).).))))))))))))))...))))))))))..(((((((....)))))))...(((...(((((....))))).)))..

Campylobacter jejuni subsp. jejuni NCTC 11168

41

GUUUUAGUCCCUUUUUAAAUUUCUUUAUGGUAAAAUNNNNNNAAGAAAUUUAAAAAGGGACUAAAAUAAAGAGUUUGCGGGACUCUGCGGGGUUACAAUCCCCUAAAACCGCUUU

((((((((((((((((((((((((((...............)))))))))))))))))))))))))).........((((.....(..((((.......))))..)..))))...

Methylosinus trichosporium OB3b

43

GCCGUGGCUUCCCUGCCGAUUUCCCUGUGGUAGGCUNNNNNNUAUGGGAAAUCGGAAGGGAAGCCACGGCAAGGUGGUUUCAUAGAAAUCACUGAAGGAUUACCCUCGUCACAGAAAUGUGGCGGGGGGAUUCCUAUU

((((((((((((((.((((((((((....................)))))))))).))))))))))))))..(((((((((...)))))))))..((((.(.(((((((((((....))))))))))).).))))...

Bacillus smithii 7_3_47FAA

45

GUCAUAGUUCCCCUAAGAUUAUUGCUGUGAUAUGAUNNNNNNUAAGAUCAUAUCACAGCAAUGAUCUUAGGGUUACUAUGAUAAGGGCUUUCUACUUUAGGGGUAGAGAUGUCCCGCGGCGUUGGGGAUCGCCUAUUGCCCUUAAAGGGCACUCCCCAUUUUAAUUU

((((((((..(((((((((((((((((((((((((............)))))))))))))))))))))))))..))))))))..((((.((((((.......))))))..))))...((((........))))...((((((...))))))................

Clostridium perfringens D str. JGS1721

45

GUUAUAGUUCCUAGUAAAUUCUCGAUAUGCUAUAAUNNNNNNUUAAUCAGGAACUAGGUAUAGCAUAUCGAGAGUUUAACUAGUUACUAUAACAAGGCAUUAAGCCGUAAAGUAUCCCCUAUGUUCAUUUGAACCUAGGGGUAUCUUUU

((((((((..(((((((((((((((((((((((..........................)))))))))))))))))).)))))..))))))))..(((.....)))..((((...((((((.((((....)))).))))))...)))).

Clostridium cellulolyticum H10

46

GUUAUAGCUCCAAUUCAGGCUCCGAUAUGCUAUAAUNNNNNNAUGGCAUAUCGGAGCCUGAAUUGUUGCUAUAAUAAGGUGCUGGGUUUAGCCCAGACCGCCAAGUUAACCCCGGCAUUUAUUGCUGGGGUAUCUUGUUUUU

((((((((..(((((((((((((((((((((((.........)))))))))))))))))))))))..))))))))..((..(((((.....))))).))(.((((.(..((((((((.....)))))))).).)))).)...

Acidovorax ebreus TPSY

47

GUUGUAGCUCCCUCUCUCACCCCGGAUAGCUACACUNNNNNNCGAUUGUGGUUAUCCGGGGUGAGAGCCGUUGCUGCAAUAAGGAGGGGUCGCAAGACCCCGUCCGUACCCAAAAGCCUGGCAGGGAAACCUGUCAGGCUUUUUU

((((((((..(..(((((((((((((((((((((............)))))))))))))))))))))..)..))))))))..((.((((((....)))))).)).........((((((((((((....))))))))))))....

Neisseria meningitidis Z2491

48

GUUGUAGCUCCCUUUCUCAUUUCGCAGUGCUACAAUNNNNNNACAUAUUGUCGCACUGCGAAAUGAGAACCGUUGCUACAAUAAGGCCGUCUGAAAAGAUGUGCCGCAACGCUCUGCCCCUUAAAGCUUCUGCUUUAAGGGGCAUCGUUUAUU

((((((((..(..(((((((((((((((((.(((((..........))))).)))))))))))))))))..)..))))))))..((((((((....))))).)))..((((...(((((((((((((....))))))))))))).))))....

Pasteurella multocida str. Pm70

49

GUUGUAGUUCCCUCUCUCAUUUCGCAGUGCUACAAUNNNNNNGCAUAUUGUUGCACUGCGAAAUGAGAGACGUUGCUACAAUAAGGCUUCUGAAAAGAAUGACCGUAACGCUCUGCCCCUUGUGAUUCUUAAUUGCAAGGGGCAUCGUUUUU

((((((((....((((((((((((((((((.((((((........)))))).))))))))))))))))))....)))))))).....((((....))))..............(((((((((((((.....)))))))))))))........

Roseburia intestinalis L1-82

52

GUUGUAAUUCCCUGUUAUCACUUGGUAUGGUAUAAUNNNNNNCUAAGAGAAUUAUAUCAUACCAAGUGAUAAUUAGGUUAUUACAAUAAGGUAAGAAACCUAAAAGCUCUAAUCCCAUUCUUCGGAAUGGGAUUAUCUUUU

((((((((..((((((((((((((((((((((((((..............)))))))))))))))))))))).))))..)))))))).((((.....))))(((((...(((((((((((....))))))))))).)))))

Alicyclobacillus hesperidum URH17-3-68

53

GUCAUAGUUCCCUCACAAGCCUCGAUGUGGUAUGAUNNNNNNGCGAGGGAUAUCAUACCACAUCAAGGCUUGCGAGGUUGCUAUGAUAAGGCAACAGGCCGCAAAGCACUGACCCGCAUUCCAAUGAAUGCGGGUCAUCUACUUUUU

((((((((..((((.(((((((.((((((((((((((.............)))))))))))))).))))))).))))..))))))))..(((.....)))...(((.(.((((((((((((....))))))))))))..).)))...

Caenispirillum salinarum AK4

58

GUCCUGUAGCCCGGUCCGUUCCACCGUGCUAGCUUCNNNNNNAUCACAGGGUGCCAUUACCAGAGAUGGUAGCACGGUGGAACGGACCGGCACCUACAGGACAAGUGAUCAUACACGUGACAGCCGCCUCCCCCGCCCCAGUGGCCAAGGGGAGGCGGCUUUUCU

(((((((((.(((((((((((((((((((..((((.............))))....(.((((....))))))))))))))))))))))))...)))))))))....................(((((((((((.(((.....)))...)))))))))))......

Ralstonia syzygii R24

60

GUUGUAGCCAGAGCGCAAUUCCCGAUCUGCUAACCUNNNNNNGACUUUCCAGCAGAUCGGGAAUUGCGCUUUGCUACUAACAAGCUGAAUCCGUUAGGAGUAAAUGCACCAAAUGAGAGGGCCGGCUUUUGCCGGCCCUUUGCUUUU

((((((((.((((((((((((((((((((((...................))))))))))))))))))))))))))).)))((((....(((....)))..................(((((((((....)))))))))..))))..

Rhodovulum sp. PH10

61

GUUGCGGUUGGGCCGCGCCGCGUUCCCUGCUAGACCNNNNNNCGUCUAGCAAGGAACGCGGCGUGGCCUCUCCGUUAACAAGGCACAUGCCACCAGAUCGAGGCGGGCUCCGGUCCGCCUCUUUGCUUU

(((((((..(((((((((((((((((.((((((((........)))))))).)))))))))))))))))..)))).)))..(((....)))........(((((((((....)))))))))........

Alicycliphilus denitrificans K601

62

GUUCCGGCCAGUGCGCAUAUCCCAGUGAUCUAGAAUNNNNNNCACUCAGUUCACUGGGAUAUGCGCUCUGACCGCUAACAAGCUGAAAGAUGCACCAAAUGGAAAGCCCCGCAUGCGGGGCUUUCGUCUUUU

(((.(((.(((.((((((((((((((((.((................)).)))))))))))))))).))).)))..)))..(((.....).))....((.(((((((((((....))))))))))...).))

Cand. Puniceispirillum marinum IMCC1322

63

GUUGCUCUAGGCUCUCAAUCACCAGAGUGCUAUACUNNNNNNGCCAUUAAUAAUUGAUUGCAAUAACACUCUGGUGAUUGAGGAGCCUAUGGUUAACAAGUGGGUUUCCUGCACAAAUCUAAGAGCUGCCUCCGGGCGGCUCUUUUGCUUU

((((.((.(((((((((((((((((((((.....................................)))))))))))))).)))))))..)).))))....((((((.......))))))((((((((((....)))))))))).......

Azospirillum sp. B510

64

GUUGCGGCUGGACCCCCGAUCCCCAUCGGCUACACUNNNNNNUGGAAAUUCGAUGGGGAUCGGGGGUCCAGCCGUUAACAUGUUCCCUUCGGGGAGCACGAAAUGCGGGGCGGGCCACGGUCCGCCCCUUUUUUU

(((((((((((((((((((((((((((((....................)))))))))))))))))))))))))).))).(((((((....)))))))..(((.(.(((((((((....))))))))).).))).

Dinoroseobacter shibae DFL 12

67

GUUGCGGCUGGACCCCGAAUUCUGAACAGCUAAACUNNNNNNGUUCAGAAUUCGCGGUCGAGCCGUUAACAAGCUCGAAGAAGCACCACAUUAAAACGCGUCCUGCGGGGCGCGUUUUCUUUUUU

(((((((((.((((.((((((((((((...............)))))))))))).)))).)))))).)))..(((......))).....(..(((((((((((....)))))))))))..)....

Parvibaculum lavamentivorans DS-1

68

GCUGCGGAUUGCGGCCGUCUCUCGAUUUGCUACUCUNNNNNNUAGCAAAUCGAGAGGCGGUCGCUUUUCGCAAGCAAAUUGACCCCUUGUGCGGGCUCGGCAUCCCAAGGUCAGCUGCCGGUUAUUAUCGAAAAGGCCCACCGCAAGCAGCGCGUGGGCCUUUUUUU

((((((((..((((((((((((((((((((((..........))))))))))))))))))))))..))))).)))...((((.((((...).))).))))..................((((....)))).((((((((((.((.....))..))))))))))....

Ignavibacterium album JCM 16511

71

GUUGGUUUAAUAUCCUCAAAGAACAAGUUGAAAGCAAAUCACAACNNNNNNUUCUGUCCCAUUUGUUGUGAUUUGCUUUUGCACAGCAUCCUUUGGACAACUUGUUCUUUGAGGAUAUUAAAACCAACCUAUCUGUUUAAGAUAGUCAAUAUCUUUUU

(((((((((((((((((((((((((((((((((((((((((((((...................))))))))))))))))).......(((...)))..)))))))))))))))))))).))))))))((((((.....)))))).............

Barnesiella intestinihominis YIT 11860

74

GUUGUGAUUCGCUUUCAAAUUUGUAUCUUUGACAUAUUAAAUACAGCNNNNNNUUAAUGUGUAAAUAUAAAAAAAUUUAUCGAAAAAUACAAUAGUAUUAAAAAAUUAUAUGUAUAUUUGUCAACACAAAUUUGAAAGCAAAUCACAAUAAGGAUUA

(((((((((.((((((((((((((....((((((......((((................((((((........))))))..............((((.........))))))))...)))))).)))))))))))))).)))))))))........

UUCCGUUGUGAAAACAUUUGGAAGGGGGAGUAUUUAUACUCCUCGUUCUUUUUU

(((((.(((....)))..))))).((((((((....))))))))..........

Odoribacter laneus YIT 12061

75

GCUGUGAUUUGAUGUAAAUACUUGAUAAGAUAUACCNNNNNNCGUUGAUUAAACAAAUCAAUUUUUACAUCUUAUCACAGCAAGGCUAUAUGCCGAAGGAUGUAAUCCUAUACUCCCGCUUCGGUGGGAGUUUUUU

((((((((..((((((((..((.....))..............(((((.........))))).))))))))..))))))))..(((.....)))..((((.....))))(.((((((((....)))))))))....

Flavobacterium branchiophilum FL-15

76

GUUGUGGUUUGAUUAAAGAUUAGAAAACACGAUAUGNNNNNNAUGUUUUAUAUAUUUGCAGCAUGAUUAAUAUUUCUAAUCUUUAAUCUUAUCACAAUAAGGCUAUAUGCCGUAGAUGAAAAUCUUUAGUCCUGCUUCGGUGGGACUUUUUUUU

((((((((..((((((((((((((((................(((((............))))).(....).))))))))))))))))..)))))))).(((((....))))).((((....))))...(((((((....)))))))........

Prevotella sp. C561

77

GUUGUACGUGCUAAUGCAAAGAUACACAUUUUGAAGCAAAUCACAACNNNNNNGUUUGUUUUAUCAGAAAUAAGUUGUAUAUUUGCACUCAGAUACACAGUGAAGACUUUUCACAACAAGGCUAUAAGCCGAAGAUUUUCUUGU

..((((......(.((((((.(((((..((((.....(((.((.(.........).)).)))....)))).....))))).)))))).)....)))).....((((.(((((.......(((.....))))))))...))))..

ACCCUGCGGUCAACCACAGGGUCUUUUUUU

((((((.((....)).))))))........

Sphaerochaeta globus str. Buddy

80

GUUGGGGAUGACCGCUGAUUUUUGUUAAGAUUGACCNNNNNNGUUAUAUCUUAACAAAAACCAGCGAUUAUCUCUAAUAAGACUUAAGUCGCAAAAUGCUCCCUAUUUUGGGAGCUUUUUUU

(((((((((((.(((((.((((((((((((.((((.......))))..)))))))))))).))))).)))))))))))..((((..))))...(((.((((((......)))))).)))...

Acidothermus cellulolyticus 11B

81

GCUGGGGAGCCUGUCUCAAUCCCCCGGCUAAAAUGGNNNNNNGAGACAGGCUACCUAGCAAGACCCCUUCGUGGGGUCGCAUUCUUCACCCCCUCGCAGCAGCGAGGGGGUUCGUUU

((((((.((((((((((......(((.......)))......)))))))))).))))))..((((((.....))))))........(((((((((((....))))))))))..)...

Akkermansia muciniphila ATCC BAA-835

85

GUUUUGCCUUGAAUCCAAAAUAAGGCACAGUACAACNNNNNNACAAAACAUCUGAACAUCACUUUAACUCCCAACGGAUUCAAGACAAAAUUUGAAAUGCAAACCGAUUUUCCUGACUGCCAGCCAGUCACACCGGUAACAAAAGCAUUUU

((((((.(((((((((.......((............................................))....))))))))).))))))...((((((.............((((((.....))))))....(....)....)))))).

Nitratifractor salsuginis DSM 16511

86

GUUUUAAGACCCCUCAAAACCCCACCCUGUUACAAUNNNNNNGUUGUAACAGGGUAGGGUUUUUUGAGGGGUCUUAAAAUCAAGAACUGUUACAACAGUUCCAUUCUAGGGCCCAUCUUCGGACGGGCCUCAGCCUUUUUUU

((((((((((((((((((..((((((((((((((((......))))))))))))).)))...))))))))))))))))))...((((((......))))))....((.((((((.((....)).)))))).)).........

a The position of the strain on the Cas9 tree is given. Color shading corresponds to the color branch of the tree. Compare with Figure 4.

b Compare the sequences with Supplementary Table S4. The predicted or previously validated repeat sequence followed by the hexanucleotide loop, represented as a string of 6 N, in red, and the tracrRNA sequence is shown. Below, the predicted secondary structure of the RNA is represented with a dot and bracket notation. The first stem-loop downstream of the anti-repeat region, when not corresponding to a putative transcriptional terminator is underlined. Note, that in type II-B loci the stem-loop found in S. wadsworthensis and P. excrementihominis is formed within the putative anti-repeat.


Share with your friends:


The database is protected by copyright ©dentisty.org 2019
send message

    Main page