Probiotic composition based on the enterococcus strain and used as a treatment means and method for the production thereof



Download 5.44 Mb.
Page60/71
Date29.11.2016
Size5.44 Mb.
1   ...   56   57   58   59   60   61   62   63   ...   71
NP471884).
Localization of genes : Glycolytic Regulator (SEQ ID NO : 9): Start position: 187 Stop position : 1218 (stop codon) Gapdh (SEQ ID NO : 1): Start position: 1285 Stop position: 2307 (stop codon) Pgk (SEQ ID NO : 3):

Start position: 2428 (Leucine) Stop position: 3630 (stop codon) Tpi (SEQ ID NO : 5): Start position: 3657 (Valine) Stop position: 4415 (stop codon) Eno (SEQ ID NO : 7): Start position: 4497 Stop position: 5825 (stop codon) Example 9: GAPDH activity on the surface of L. plantarum 299v Detection of GAPDH activity in untreated culture samples As described in Example 3, GAPDH appeared as a major band when proteins re- leased from the cells in PBS were analyzed by SDS-PAGE. To test whether the surface-located GAPDH protein was enzymatically active, we performed activity assays on untreated culture samples. NAD and NADH, which take part in the GAPDH reaction, are not taken up by intact cells. Therefore, the intracellular GAPDH will not be detected without prior lysis or permeabilization of the cells. We refer to the activity measured in untreated culture samples as"extracellular/surface located".


GAPDH assay was performed with a modification of the procedure described by Gil- Navarro et al. (1997). 16 pL sample was mixed in a 1 cm light path cuvette with reaction mixture to a final volume of 0. 8 mL. The reaction mixture contained 1 mM NAD and 2 mM glyceraldehyde 3-phosphate in 0,1 mM dithiothreitol, 5 mM EDTA, 50 mM sodium phosphate and 40 mM triethanolamine, adjusted to pH 8.6 with HCI.
A mixture without glyceraldehyde 3-phosphate was used for control reactions. Activ- ity of GAPDH causes an increase in absorbance at 340 nm (A340) as NADH is formed during the reaction. The reaction took place at room temperature (25 +/- 3 C). A340 was measured at intervals throughout a total incubation time of 5-180 min, depending on the activity of the sample. For each sample, the slope of A340 versus time was calculated, and the slope of the control reaction without glyceralde- hyde 3-phosphate was subtracted. Further correction was made for A340 decrease in

reaction mixture with buffer added instead of sample. To obtain the activity in units/mL, the corrected slope was multiplied by the reaction volume and divided by the sample volume and the millimolar extinction coefficient of NADH, 6.3 (mM-cm)'\ 1 unit of GAPDH will catalyse production of 1 umole 1, 3-diphosphoglyceric acid per minute.


L. plantarum 299v was grown without shaking or aeration at 30 C in MRS broth (De Man et al. ; 1960) prepared from dehydrated medium (OXOID Ltd. , Basingstoke, Hampshire, England). The extracellular/surface-located GAPDH activity was found to be low during active growth of the cultures, but increased in stationary phase to above 0.05 u/mL. Thus, the extracellular/surface-located GAPDH appears to be growth phase dependent.
Development of the sMRS medium In further experiments we obtained low and variable results, which appeared to be related to the use of different batches of MRS broth. This indicates that the dehy- drated MRS broth contains varying amounts of components that directly or indirectly influence the amount of surface-located GAPDH.
To improve the reproducibility of surface-located GAPDH activity, we composed a medium designated sMRS. In composition this medium (shown in Table 9-1) is similar to MRS, but the concentrations of hydrated salts (like sodium acetate tri- hydrate) have been increased to correct for the weight of water, and the yeast extract concentration has been increased 25%. Furthermore, the procedures for preparation differ. The dehydrated MRS broth contains all the final components, which are dissolved in water and autoclaved together. For preparation of sMRS, some components are sterilised separately to avoid breakdown or precipitation of important nutrient factors: A basal medium consisting of peptones and meat extract are autoclaved with

Tween 80, salts, acetate and citrate.


Glucose and phosphate buffer are autoclaved as separate stock solutions.
Yeast extract is filter-sterilised (0. 22 um pore size filter).
The final medium is mixed aseptically, when the autoclaved stock solutions have cooled down.
Both media were stored at 2-8 C.

Fig. 9 shows the results from parallel cultures in sMRS and in a low-yielding batch of MRS. GAPDH assays were performed in untreated culture samples taken in late growth phase (OD600 7.5-8. 6) and again 22 hours later in stationary phase (OD600 12-12.5). Even after such prolonged incubation, the GAPDH activity in the MRS cultures was below 0.03 u/mL. In the sMRS cultures, GAPDH activity followed the pattern observed earlier for some other batches of MRS, i. e. increasing activity in stationary phase. Using sMRS, we consistently obtained high activities in untreated samples from stationary phase cultures. Therefore, sMRS was used in all subsequent experiments on the surface-located GAPDH, unless otherwise stated.


Table 9-1

sMRS MRS (Oxoid)

Component Final conc. Component Final conc.

Bacto tryptone 10 g/L Peptone 10 g/L

Beef extract 8 g/L Lab-Lemco Powder 8 g/L

Yeast extract 5 g/L Yeast extract 4 g/L

Tween 80 0.1% (v/v) Tween 80 0.1% (v/v

NaAc'3 HzO61 mMNaAc-3 H2037 mM

(NH4) 2-Hcitrat 8.8 mM (NH4)2-Hcitrat 8. 8 mM

MgSO4#7 H2O 1. 6 mM MgS04-7 H20 0. 8 mM

MnSO4#H2O 0.27 mM MnSO4#H2O 0.22 mM

Glucose 20 g/L Glucose 20 g/L

K2HPO4 7. 2 mM K2HPO4 11. 5 mM

KH2PO4 4. 8 mM

Final H 6. 3+/-0. 1 Final H 6. 2+/- 0. 2

Influence of growth conditions and incubation time Cultivation of L. plantarum 299 at 30 C and 37 C resulted in comparable activities of extracellular/surface-located GAPDH, e. g. 0.34 u/mL at 30 C and 0.30 u/mL at 37 C for parallel stationary phase cultures. Unless another temperature is specified, cultivation temperature was 30 C.


The ratio between the culture surface and the volume of the cultivation medium was found to influence the amount of GAPDH activity located extracellularly and/or on the cell surface. This was demonstrated by growing L. plantarum 299v in two screwcapped 15 mL tubes containing 5 mL sMRS medium. Incubating one tube horizontally and the other in an upright position resulted in a remarkable difference in extra- cellular/surface-located GAPDH activity, as shown in Table 9-2. The difference is

probably connected to the exchange of oxygen, carbon dioxide and/or volatile metabolites between headspace and culture liquid. If nothing else is stated, the Lactobacillus strains were cultivated in closed tubes or flasks in upright position and with a medium to headspace ratio of at least 0.25.


Table 9-2. GAPDH activity (u/mL) in untreated culture samples of L. plantarum 299v Days of incubation

Position of cultivation tube 1 2

Vertical 0. 268 0. 461

Horizontal 0.059 0.004

In sMRS-cultures, extracellular/surface-located GAPDH of L. plantarum 299v increased with incubation time up to 3 days as shown in Fig. 10. In contrast, Lactoba- cillus plantarum WCFS1 (Kleerebeezem et al. ; 2003) showed no or very low activity ( < 0.03 u/mL) during the entire incubation period.
Elution of GAPDH from the cell surface As expected from the analysis of surface proteins by SDS-PAGE the major part of the extracellular/surface-located GAPDH activity remained attached to the cells during harvest but was easily released by washing the cells as follows : Culture samples were harvested by centrifugatlon at 4 C for 5-T min at 14, 00 x g. The cells were resuspended in an equal volume of PBS buffer at room temperature and har- vested again. The washed cells were resuspended in the same volume of PBS and kept on ice. GAPDH activity was determined in culture supernatant, in supernatant from washing in PBS and in the suspension of washed cells. Fig. 11 shows the results from washing cells from a stationary phase culture of L. plantarum 299v.
89% of the activity was found in the supernatant from washing in PBS; this fraction will in the following text be referred to as ESP (Eluted Surface Proteins).
Elution of GAPDH was dependent on pH; adhesion of GAPDH to the cells was not affected by washing in a pH 4.5 buffer of a composition similar to PBS (0.14 M sodium chloride and 0.01 M potassium dihydrogen phosphate), (data not shown).
Thus, adhesion of GAPDH to the cell surface is allowed at low pH, which is the natural environment of Lactobacillus.

Specific surface-location of GAPDH In order to investigate whether the surface-located GAPDH activity was a result of cell lysis, the intracellular enzymes L-and D-lactate dehydrogenase (LDH) were used as indicators of cell lysis. The assay, which measures the sum of the L-LDH and D-LDH activities, was performed by a procedure that is analogous to the GAPDH assay. In the case of LDH, the reduction of pyruvate at the expense of NADH was measured as a decrease of A340 with time. The reaction mixture consisted of 10 mM sodium pyruvate and 0.2 mM NADH in 63.2 mM potassium dihydrogen phosphate and 3.5 disodium hydrogen phosphate (Bernard et al. ; 1994).


To be able to compare extracellular and intracellular activities, washed cells were lysed by ultrasound treatment with glass beads: 500 uL of cell suspension in PBS was mixed with an equal volume of glass beads (Sigma G 9143,212-300 urn) and subjected to ultrasound at maximum effect in an ultrasound bath (Elma Transsonic Digital S) with ice for a total of 15 min. Cells and glass beads were mixed at 1-2 minute intervals by inversion of the tubes. The resulting lysate represent the intracellular fraction plus the proteins still attached to the cell surface after washing. The latter can be measured in the suspension of washed cells, and in the case of GAPDH and LDH, the activities were low (see below). For simplicity, we will refer to the GAPDH and LDH activities measured in the lysate as"intracellular".
LDH and GAPDH assays were performed on the lysate, culture supernatant, ESP fraction, and washed cells suspension of a stationary phase L. plantarum 299v culture. The results are shown in Fig. 12. The culture supernatant and the suspension of washed cells contained only negligible amounts of LDH and GAPDH activities. In the lysate, both activities were high (3 u/mL of LDH and 1 u/mL of GAPDH).
The ESP fraction contained a high activity of GAPDH (0.37 u/mL) and, surprisingly, also a significant amount of LDH activity (0.09 u/mL). This could indicate that LDH, like GAPDH, was presented on the cell surface in the stationary phase culture.
However, there is a clear difference between the distribution ratios of the two activities between the ESP fraction and intracellular fraction (Table 9-3). If both LDH and GAPDH had been released by lysis, the ratios would be expected to be more equal.
This indicates that GAPDH in the ESP fraction is transported to the cell surface by an alternative, specific mechanism, resulting in the presence of stable GAPDH as a major protein species on the surface of Lactobacillus.

Table 9-3


Culture fraction GAPDH u/mL LDH, u/mL

ESP 0. 37 0. 09

Intracellular 0. 97 3. 07

I-ESP/Intracellular ratio 0. 38 0. 03

Development of a procedure for cultivation and GAPDH-testing in microtiter plates To be able to screen a larger number of strains for the presence or absence of extracellular/surface-located GAPDH, we developed a procedure for growing and assaying in microtiter plates. Growing the microtiter cultures in an oxygen-depleted, carbon dioxide-enriched atmosphere allowed display of extracellular/surface-located GAPDH activity in spite of the low volume to surface ratio in the wells.
The Lactobacillus strains were inoculated in 150 or 200 uL sMRS in 300 uL wells in sterile microtiter plates (96 well polystyrene plates with round-bottom wells, Nunc a/s, Roskilde, Denmark). The microtiter plates were incubated at 30 C with Anaerocult A or Anaerocult IS (Merck, Darmstadt, Germany) in anaerobic jars or sealed polyethylene bags or in an atmosphere of 10% H2, 10% CO2, 80% N2 in a MK3 Anaerobic Work Station (DW Scientific, Shipley, West Yorkshire, UK). After 40- 48 hours at 30 C, the culture in each well was mixed with a pipette and a sample of 5 uL was transferred to the corresponding well in another microtiter plate where it was mixed with 120 or 150 uL reaction mixture. The reaction mixture contained 1 mM NAD and 2 mM glyceraldehyde 3-phosphate in 0. 1 mM dithiothreitol, 5 mM EDTA, 50 mM sodium phosphate, and 40 mM triethanolamine, adjusted to pH 8. 6 with HCI. After incubation at ambient temperature for 30-120 min, the plates were photographed on a UV trans-illuminator. Wells with GAPDH activity were identified by their yellow fluorescence (450 nm). The microtiter plate-based GAPDH assay was used for screening purposes as described in example 14 and 15.
Example 10: Expression and purification of recombinant PGK, GAPDH and ENO and generation of antibodies.
The coding regions of the PGK, GAPDH and ENO encoding genes were amplified from the genome of Lactobacillus plantarum 299v by PCR. The PCR was performed on the three individual genes using total DNA from L. plantarum 299v and three sets

of primers containing engineered BamHl (GGATCC) and Xhol (CTCGAG) recognition sites:


Primer Name Pgapdh frw (SEQ ID NO : 30) TAGTAGGATCCATGTCCGTAAAAATTGGTATTAAT Pgapdh rev (SEQ ID : 31) GGCCGCTCGAG TTAGAGAGTGGCGAACTTCAATAA Ppgkfrw : 32) TAGTAGGATCCATGGCTAAATTAATCGTTT Ppgk rev (SEQ ID NO : 33 GGCCGCTCGAGTTATTTTTCAGAAATAGCAG Peno frw (SEQ ID NO : 34) TAGTAGGATCCATGTCTATTATTACAGATAT Peno rev (SEQ ID : 35) The resulting PCR products were 1225 bp comprising the pgk gene, 1351 bp com- prising the eno gene and 1022 bp comprising the gapdh gene and contained the translation start site (ATG) and the stop codon (TAA) of the each gene. The DNA fragments were BamHI/Xhol-digested and cloned into the same sites of the pGEX- 4T-3 (Pharmacia) expression vector. The ligation mixtures were transformed into E. coli DH10 (Invitrogen, Carlsbad, CA, USA) according to standard procedures. In the pGEX-4T-3 system the recombinant PGK, GAPDH and ENO are produced as a fusion protein with the 26 kDa glutathione-S-transferase (GST) polypeptide. Follow- ing IPTG induced expression the PGK, GAPDH and ENO fusion proteins were purified from the E. coli extracts. However, to avoid the direction of recombinant fusion proteins into insoluble inclusion bodies, the procedure for induction and ex- pression were optimised as follows. Overnight E. coli cultures were diluted 50 times in 100 mL fresh LB medium containing 100 llg/mL ampicillin and were incubated for 2 h at 37 O in large 1000 mL flasks at 200 RPM. The temperature was lowered to 25 G and after 0. 5 h IPTG was added to a final concentration of 0. 1 mM. Expression was allowed overnight at 25 C and 200 RPM. Harvested cells were washed in 5 mL PBS and sonicated. Lysates containing the GST fusion protein were added to the Glutathione Sepharose 4B Redipack column and eluted with glutathione according to the manual of the supplier (Amersham Biosciences). Antibodies were raised against the PGK, GAPDH and ENO fusion proteins respectively, by immunising rabbits three times with 100 pL 1 mg/mL of recombinant protein. The anisera were evaluated by western blot analysis using the following protocol. Pre-cast 14% Tris- glycine gels from nitrogen were used for SDS-PAGE, and proteins were blotted to nitrogen type 2 nitrocellulose membranes using an Xcell II blot module from Invi- trogen. Membranes were blocked with a solution of 3% skim milk powder. As pri- mary antibody either anti-GAPDH, anti-PGK or anti-ENO raised in rabbits was used.
As secondary antibody alkaline phosphatase-conjugated goat anti-rabbit antibody

from Dakocytomation (Glostrup, Denmark) was used. Blots were developed using NBT/BCIP tablets from Roche Diagnostics (Penzberg, Germany). Fig. 13 shows the cross reaction against the GAPDH fusion protein and the wild type GAPDH protein from L. plantarum 299v.


Example 11: Extracellular/surface-located activity of Lactobacillus spp.
To assess how frequently GAPDH surface display occurs among Lactobacillus species, we screened the extracellular/surface-located activity of 23 strains from the Lactobacillus species L. plantarum, rhamnosus, gasseri, casei and paracasei. Each strain was inoculated with a small amount of material ( < 50 uL) from a frozen cryoculture into 5 mL of sMRS medium and incubated in a 15 mL screw-capped tube at 30 C for at least 45 hours. Strains that had not developed a dense culture in 2 days were incubated for one additional day. OD6oo was measured and GAPDH and LDH activity was determined in untreated culture samples. For detection of GAPDH and ENO by Western Blotting, ESP-fractions were prepared from the cultures and frozen for later analysis.
Each strain was tested twice in independent cultures on different days. Fig. 14 shows the extracellular/surface-located activities as a mean of the result from the two tests. Six of the nine Le olantarum strains, 299v, ATCC14917, B, 299, P, and Q, showed similar activities of GAPDH (average above 0. 2 u/mL) and LDH (average below 0.02 u/mL). L. plantarum ATCC8014 differs by a higher LDH activity. L. plantarum C had a lower GAPDH activity (0. 15 u/mL) and an LDH activity below 0.02 u/mL. As observed earlier, strain WCFS1 diverges by showing low activities of both enzymes. L. rhamnosus strains ATCC7469, E, R, GG, and T varied considerably with respect to extracellular/surface-located GAPDH activity. Only two of the strains, E and T, showed activities that were comparable with those of L. plantarum 299v. LDH was low in all tested strains of the L. rhamnosus species. Only the L. gasseri AA and Z showed high GAPDH/LDH ratios indicating that GAPDH is not directed to the surface by means of lysis. The other L. gasseri tested showed low GAPDH/LDH activity ratios indicating that the extracellular GAPDH activity is due to lysis. Both activities were low in the cultures of the tested L. casei strain. For L. paracasei the extracellular/surface-located GAPDH activity is lower than that of L.

plantarum 299v. However, their GAPDH/LDH activity ratios show specific transport of GAPDH to the cell-surface of L. paracasei. The data of the GAPDH/LDH activity ratios (Fig. 14) correlates with the Western blot of the ESP fractions of the cultures (Fig. 15). Furthermore, high activities and amounts of surface located GAPDH correlates with high amounts of ENO at the surface (Fig. 15). This suggests a similar mechanism of transport of GAPDH and ENO to the cell-surface of Lactobacillus species. In conclusion, the surface display of GAPDH and ENO is a widespread phenomenon among Lactobacillus species.


Example 12 : Immobilized binding assay.
The role of GAPDH and ENO proteins as an adhesin was evaluated by immobilised binding assay using components of the epithelial lining. GAPDH and ENO were eluted from the surface of L. plantarum 299v using the procedure described in ex- ample 9. Subsequently, the eluted surface proteins (ESP) were concentrated 20 times using 4 mL spin columns with cut-off at MW 10 kDA (Millipore, MA, USA).
Maxisorb microtiter wells (Nunc, Roskilde, DK) were coated with 20 llg/mL human plasma fibronectin (Sigma-Aldrich, St. Louis, MO), 20 llg/mL porcine mucin (Sigma- Aldrich) or 20 llg/mL human plasminogen (American Diagnostica, CT, USA). Wells coated with 0.5% bovine serum albumin (BSA) alone served as negative control.
Immobilisation was allowed for 3 h at 37 C with lid on. Unbound components were removed by rinsing the wells five times with PBS-0. 2% Tween 20. Free sites in the wells were blocked with 0. 1% BSA containing 0. 2% Tween 20 for 30 min at 500 RPM. Excess BSA was removed by a PBS-0. 2% Tween 20 wash. A 2-fold dilution series of the 20 times concentrated ESP were titrated onto the wells followed by incubation for 1 h at 37 C. Plates were washed in PBS-0.2% Tween 20 and bound protein were detected after overnight incubation at 4 C and 500 RPM with a 1: 1000 dilution of rabbit anti-GAPDH or anti-ENO serum diluted in PBS containing 0. 1% BSA and 0.2% Tween 20. After five further washes with PBS-0.2% Tween 20, a 1: 4000 dilution of goat anti-rabbit AP-conjugated antiserum in PBS with 0. 1% BSA and 0.2% Tween 20 were added to the wells and incubated at room temperature for 1.5 h and 500 RPM. After five further washes in PBS containing 0. 1% BSA and 0.2% Tween 20, wells were washed in H20. Finally, bound AP-conjugated antibod- ies were detected by addition of p-nitrophenyl phosphate (Sigma-Aldrich) in 1 M diethanolamine, 0.5 mM MgCI2 for 15 min at room temperature. Plates were read in an ELISA plate reader.

As shown in Fig. 16 GAPDH binds to immobilised fibronectin in a concentration dependent matter. Also, ENO binds specifically to fibronectin and as showed using GAPDH it has low nonspecifically binding to the control protein BSA (Fig. 17). The specific affinity of GAPDH and ENO towards plasminogen is significant and the binding curves display saturation at lower GAPDH and ENO concentrations than that towards fibronectin (Fig. 18 and Fig. 19). Thus GAPDH and ENO binds more strongly to plasminogen than to fibronectin. Furthermore ENO shows a higher affin- ity to plasminogen than that of GAPDH. The adhesion properties of GAPDH and ENO to mucin were also investigated. These results show that GAPDH specifically binds to immobilised mucin (Fig. 20). However, the affinity of ENO to mucin is low and not significant (Fig. 21).


The conducted binding studies suggest a role of extracellular located GADPH and ENO as adhesion-components during adherence and colonization of L. plantarum 299v.
Example 13 : Role of surface proteins in dendritic cell stimulation Dendritic cells play an essential immunoregulatory role in the Th1, Th2, and Th3 cell balance and are present throughout the gastrointestinal tract. Thus, dendritic cells may be targets for modulation by gut microbes, including ingested probiotics. It has been shown that incubation of dendritic cells with killed Lactoloacillus induces a strain dependent cytokine production. In this example the eluted surface proteins from the surface of L. plantarum 299v were tested for immunomodulating potential.
Bone marrow cells were isolated from the femora and tibiae from two female C57BL/6 mice, 8-12 weeks old (Biocentrum-DTU, DK), which were removed and stripped of muscles and tendons. After soaking the bones in 70% ethanol for 2 min and rinsing in PBS, both ends were cut with scissors and the marrow was flushed with PBS using a 27-gauge needle. Cell clusters were dissociated by repeated pipetting using a 10 mL serological pipette. The resulting cell suspension was cen- trifuged for 10 min at 300 x g and washed once in PBS.
Cells were resuspended in RPMI 1640 (Sigma-Aldrich, St. Louis, MO, USA) sup- plemented with 4 mM L-glutamine, 100 U/mL penicillin, 100 ug/mL streptomycin, 50 , uM 2-Mercaptoethanol, 10% (v/v) heat-inactivated FBS (Atlanta Biologicals, Nor-

cross, GA, USA), and 15 ng/mL murine GM-CSF. GM-CSF was added as 5-10% (v/v) culture supernatant harvested from a GM-CSF-producing cell line (GM-CSF transfected Ag8. 653 myeloma cell line) and GM-CSF was quantified using a specific ELISA kit (BD PharMingen, San Diego, CA).


To enrich for dendritic cells, 10 mL of cell suspension containing 3x106 leukocytes was seeded in bacteriological petri dish (day 0) and incubated for 8 days at 37 C in 5% CO2. An additional 10 mL of freshly prepared medium was added to each plate on day 3. On day 6,9 mL from each plate was centrifuged for 5 min at 300 x g, resultant cell pellet was resuspended in 10 mL of fresh medium, and the suspension was returned to the dish. On day 8, cells were used to evaluate effects of the ESP from L. plantarum 299v on cytokine release.
Nonadherent cells were gently pipette from the petri dishes containing 8-day old dendritic cell-enriched cultures. The collected cells were centrifuged for 5 min at 300 x g and resuspended in medium supplemented with only 10 ng/mL GM-CSF. Cells were seeded in 48-well tissue culture plates at 1.4 x 106/500 uL/well. The 20x con- centrated ESP from L. plantarum 299v was then added at 100 pL/well in a series of 2 fold dilutions. The PBS alone was used as negative control. Furthermore, wells containing 100 . I supernatants of the L. plantarum 299v cultures were included.



Share with your friends:
1   ...   56   57   58   59   60   61   62   63   ...   71


The database is protected by copyright ©dentisty.org 2019
send message

    Main page