Additional File 5 1 Summary of insitu hybridization probes



Download 119.5 Kb.
Date06.02.2017
Size119.5 Kb.
Additional File 5
5.1 Summary of insitu hybridization probes.

A. Probes obtained from other laboratories

Gene

Reference

RGS4

(Grillet et al., 2003)

Sostdc1 (ectodin)

(Laurikkala et al., 2003)

Msc, MyoR

(Lu et al., 1999)

NeuroD1

(Tomita et al., 2000)

Htr3a

(Zeitz et al., 2002)

NpyR1

ATCC accession #10469632



B. Probes generated by PCR

Probe

5’ oligonucleotide

3’ oligonucleotide

Antrx2

CGATAGCCCATGATTCACGACACT

CGTTGACGAGACACGATGGTGATA

Avil

CAGTCACAGAGGTGGCAACAAGGCCC

CTCCGCAGCAGAAAGACGTCGTTGG

Bnc

ACCTGGCAAGCTCTGAGACC

CTTTCGACTCTTCCAGAAAAGG

Dgkh

CATAGCGGTGTTGAACATCCCT

CGTGAGGAGATTCCAAGTGCA

Ednrb

ACACTCGCCGAATCTCACTGTCCT

CGAGAGAGCTGGTTACAGTGACTA

Gpr64

ATGTCATTCTCGTTACATCCCTGAA

AAGCTTTCTCCATCTGGGATACTTG

Lgals7

TGGAAAGGGAGGAGCTGAACCACT

TACAGCTACACTTTATTCGCCATC

Lix1

CAAGGAGTTCATCATGGAGAGTGTT

TTCAATTTTCAGGGAGTTCATAGCA

Lxn

CCCAAGATGGAAATCCCACC

CGGTTGTCTACGGGTTAGCG

Pla2g7

AGATCTGATGTTCGGTTATGGGAAT

AATCAGGTTCTCATCATCTCCTTCC

Ptprr

GATGGTTTGCATCAGAGTTTACCAC

GTGTGACTTCCTTGCTTTAAGACGA

Tbx3

GGTCTCTCCATTCCAGTTTGGTCA

TGCAGCCAGCTCTACTTGAAAGCA



References for additional file 5.1
Grillet, N., Dubreuil, V., Dufour, H. D. and Brunet, J. F. (2003). Dynamic expression of RGS4 in the developing nervous system and regulation by the neural type-specific transcription factor Phox2b. J Neurosci 23, 10613-21.

Laurikkala, J., Kassai, Y., Pakkasjarvi, L., Thesleff, I. and Itoh, N. (2003). Identification of a secreted BMP antagonist, ectodin, integrating BMP, FGF, and SHH signals from the tooth enamel knot. Dev Biol 264, 91-105.

Lu, J., Webb, R., Richardson, J. A. and Olson, E. N. (1999). MyoR: a muscle-restricted basic helix-loop-helix transcription factor that antagonizes the actions of MyoD. Proc Natl Acad Sci U S A 96, 552-7.

Tomita, K., Moriyoshi, K., Nakanishi, S., Guillemot, F. and Kageyama, R. (2000). Mammalian achaete-scute and atonal homologs regulate neuronal versus glial fate determination in the central nervous system. Embo J 19, 5460-72.

Zeitz, K. P., Guy, N., Malmberg, A. B., Dirajlal, S., Martin, W. J., Sun, L., Bonhaus, D. W., Stucky, C. L., Julius, D. and Basbaum, A. I. (2002). The 5-HT3 subtype of serotonin receptor contributes to nociceptive processing via a novel subset of myelinated and unmyelinated nociceptors. J Neurosci 22, 1010-9.



5.2. Locus-ChIP oligonucleotides. The position of each oligonucleotide pair is given relative to the transcription start site.





A. Tcfap2b oligonucleotides

Name

Position

Sequence (5'-3')

AP2B-30 F

-9904

GGAGCTGCCTTGAGATCTTCA

AP2B-30 R




GGCACGTACAGTGCTGGAGTT

AP2B-32 F

-7582

CTGAGCTTCCTAGGTCCCATTGT

AP2B-32 R




ACTGGGCAGGATGCTTGC

AP2B-34 F

-5292

ACTGGCACTGTGGACTACAGCTC

AP2B-34 R




AGCTTAACTATAAATTGGAAGCTGGG

AP2B-35 F

-4424

CATGAGCAATAAACCTTGTGATGG

AP2B-35 R




AAAACCTTTGCATGGTGGACAT

AP2B-36b F

-3730

AGCTGGCAGGAACAGTGCTT

AP2B-36b R




CACCATTTAAACTTTGGTCACCG

AP2B-36 F

-3095

ATGCGTAACGGGAAACGTGT

AP2B-36 R




CATGCGCTTTGGGTAAGAGC

AP2B-37 F

-2614

TCCTACAGAGGGCGGTGTTG

AP2B-37 R




AAATCCCAGCTATTTCGCCA

AP2-38B F

-1868

TAAGTCCTTCCACACAACGACATT

AP2-38B R




CCCTTTCGCCACCAGAGAT

AP2B-38 F

-1435

TCCTCAGCTTGGCTGTTAGGA

AP2B-38 R




GGAGGCTCCGTGAGTAGGAGA

AP2-39B F

-825

TCACAAATTACAGGCAATAAACCC

AP2-39B R




ATGTTAATCTTGAGACCTTTAACAGGG

AP2B-39 F

-352

GGACTGATGTGCGTGGTTTCT

AP2B-39 R




AATGGCGAATCAATGCAGC

AP2B-40b F

80

GAGCGTCGGATTTGGTGTGT

AP2B-40b R




TTCTCAGGACTCCGCTGTCTG

AP2-40c F

545

GAGCCAGGAATTCAGGCAAAC

AP2-40c R




CCCGATTCTGTCCCGTACTC

AP2-41b F

1300

GCAGAGGTGGACAACCCAGA

AP2-41b R




CAACACCTACAAGGCTCACGG

AP2B-41 F

1724

TACTGAGGAACCGCGCCTC

AP2B-41 R




GGAGTTGAACATAATCCCGCC

AP2B-42 F

2215

CCCAACGTGGTAGAAGGAGC

AP2B-42 R




GGCCTGACTGCCATTTCTGT

AP2-42b F

2645

CCCCACCAGATAATCAGGCA

AP2-42b R




GTAGTCTTGGGTGCTTGGTGTG

AP2B-43b F

3161

TGCAGAAGAAAAGAGGCCAAA

AP2B-43b R




GAGGTGCCTGTCACAGACAGG

AP2B-43 F

3653

AATTGGTAGAGGCCGCAGC

AP2B-43 R




CCCAGCTTACTCCAGGAGCTC

AP2B-44 F

4429

GCTGGGTAGTGGGTGAGCTTC

AP2B-44 R




GTCAATAGCTCCACACCGGG

AP2B-45 F

5687

GGAGAAGTTGGCACCAGGAG

AP2B-45 R




AGATAGCCAGCACTTTGCCC

AP2-46 F

6592

GCAAAACGTGGTGATTGTCAA

AP2-46 R




CAAGGTTCCTCTAAAACAATGAAGC

AP2B-47 F

7300

CCCTTAGCTGGTAGCCTGGC

AP2B-47 R




CTTCTCGAACTTAGGGCCCA

AP2B-48 F

8521

CGCACCAACATGGTTGTGA

AP2B-48 R




CCTGGGAGTGAAACCCATCA

AP2B-49 F

9580

CAGCGAGCAGCAAGAAGCT

AP2B-49 R




GCCTCCAGGACCTCACACC

AP2B-51 F

11679

CTCCCTCTTTGTGGCAAGCTA

AP2B-51 R




CTCTGCCAGCCAATTGATGTT

AP2B-52 F

12717

AGCAAACGAGTGGAGTGAAGG

AP2B-52 R




GCCGTAAACGAGCTCTGGAG

AP2B-53 F

13569

TTTTGCCCCAGGAGTCTGAG

AP2B-53 R




TGGAAAGGCAAAGTTATTGAGAGG



B. Gata3 oligonucleotides

Name

Position

Sequence (5'-3')

dpGATA 97 F

-10239

CACCAGGAGCAGGTCACATTT

dpGATA 97 R




AACCGCACATCAGAGGTGTGT

dpGATA 98 F

-8746

CTTTGTGCAGCCCCTCACTC

dpGATA 98 R




AGCTTCTTGTTTAGAAATAACCTGCC

dpGATA 99 F

-7779

GGCTAGGGTGATGTTGAATGC

dpGATA 99 R




ACCTCTGAGAGCACCTGGCA

dpGATA 100 F

-6839

ACTTCCCAGTGGGTCACCC

dpGATA 100 R




TGTGCACTTTCTAGCTATCCGTG

dpGATA 101 F

-5571

CGGCTTTTCTCCTCTCAAACA

dpGATA 101 R




TTTCTTGGAGCATGGGTTGG

GATA-102 F

-5000

GATCGAGCTGGAATGGGAAG

GATA-102 R




TTAAATTCACAGCCCGGGAC

dpGATA 103 F

-4236

TGTCTCAGCTTACTCCACGCA

dpGATA 103 R




GGTATGTGTGCCCTCTTGGG

GATA-103b F

-3425

TGACGTCAAACCCAGTGTGG

GATA-103b R




GAAAGAGGACGTTGCTCTTTTGAT

dpGATA 104 F

-2704

GGTTTCCGGTGAATGTTAGACAG

dpGATA 104 R




GCTGCCAGCATCTCTTCCAG

GATA-104b F

-2161

GGATGACGCCTTCAGTTCCA

GATA-104b R




GGTGTTCCCATTCCACCCTC

dpGATA 105 F

-1667

AGAAAAGTTAGGCTATCGCAGCA

dpGATA 105 R




ACCTAGGCTCACTGGTCCCC

GATA-105b F

-1203

CAGCCGGGTTTCACTCGTAC

GATA-105b R




GGCCCTTTAAATGTAGCAAAGC

GATA-106b F

-694

GAGCTACGCAATCTGACCGG

GATA-106b R




CAACCTGAGTAGCAAGGAGCG

GATA-106c F

-206

TGATCGGAAGAGCAACCGTC

GATA-106c R




AGAGAGGAATCCGAGTGTGACC

GATA-107 F

242

CTCAACGGTCAGCACCCAG

GATA-107 R




AGCGGATACTGAGCTTCCATG

GATA-107b F

340

CATCGATGGTCAAGGCAACC

GATA-107b R




GATACCTCTGCACCGTAGCCC

dpGATA 108 F

579

GAGGAAGCAGTGTCGCTGGT

dpGATA 108 R




CCTGCTACGTGCGCTCTTTT

GATA-108b F

1070

CCCGGCTACACAGAATTTTCC

GATA-108b R




GAGAAAAGTCGGCCAGGATTG

dpGATA 109 F

1821

AATGTCAAATGGTGAGGCGG

dpGATA 109 R




TTTAAACTCGGAGCGCAAATC

dpGATA 110 F

3335

GATCCCCTACCGGGTTCG

dpGATA 110 R




GGTAGAGGTGGCGCTTACCTG

dpGATA 111 F

4142

TGGGAGTTGATTGGAGGCC

dpGATA 111 R




GGGAGAGCAGAGGCACACAC

dpGATA 112 F

4931

AGTGTGGTCTGCTGAAGGTGC

dpGATA 112 R




CTGTTTCTAGTCCACCGCCC

dpGATA 113 F

6178

TTAGGAAAATTGGCTGTGTACTGAA

dpGATA 113 R




CCTTGCGTGTGTTTTTCTCTTGT

dpGATA 114 F

6752

CTCCCCACAGCCACTAGCC

dpGATA 114 R




TGGGCCGCTTCCTAGTCAG

dpGATA 115 F

7978

TGCAGATCTCCTGCCTAAAGG

dpGATA 115 R




AGTCAGCTCTTTAGCCCCAGC

dpGATA 116 F

8939

TACCTTTGCAATGCCTGCG

dpGATA 116 R




CGCTTGGGCTTGATAAGGG

dpGATA 117 F

10077

ACACCCGCTTCCTTAAAGCA

dpGATA 117 R




GGATGTGAAAGGTGTTAAGTCGTG

dpGATA 118 F

10924

GCTACACAGAGACACGGAGACTTTT

dpGATA 118 R




ACACACCCCATAGCATGCAG

dpGATA 119 F

11881

AGAGAGCACAAGAGGGAAATGG

dpGATA 119 R




CATTTGGCCACCTGCCTTT

dpGATA 120 F

12712

CGTGTTCGCCATTGTAGGAA

dpGATA 120 R




TCCCTAAACCTGAGTGGTGGA

dpGATA 121 F

14192

CCTGGCTAATTGGAAATTGCC

dpGATA 121 R




CCTCCCTGGGAACATTACCA



C. NeuroD4 oligonucleotides

Name

Position

Sequence (5'-3')

dpM3 101 F

-9220

TGCTTTATACTGCAGAGCATCCA

dpM3 101 R




TTCTGTAAAGGGCACACTGTTTTC

dpM3 102 F

-7994

GGCTCTCTGAGGACCAGCC

dpM3 102 R




TGCACATGTTCCCCAATTTG

M3-103 F

-7190

CAGGTGGCAATATCTACCCCA

M3-103 R




GGTACCAGCTGAGGCCAGG

dpM3 104 F

-6567

GGGAACAGGCAAATTCTACCC

dpM3 104 R




TCCCAACTTGGAGGTTCATTG

dpM3 105b F

-5700

CCCACATGATGGCTCTCAACT

dpM3 105b R




GCCCAAGGAGTCCAGAAGAAG

dpM3 106 F

-4351

AGTTTCACAGAGCAGGGAAGGTC

dpM3 106 R




TGCACCTCAGGGTCTGTCC

M3-106 b F

-4700

TCACAGTTTTAGGAGTGTCATTCCA

M3-106 b R




TCGGGCAAAATGAGTCACTCT

dpM3 107 F

-3417

CCTTATTACCCCCAATTACATATGGTA

dpM3 107 R




GACAGGACATCAGACAGCTTATTTTC

dpM3 108 F

-2505

TTCAACCTGTTCCCTTCTATTGC

dpM3 108 R




AATTTGAGCAGACCCTGAGCC

dpM3 109 F

-1745

GATTGCACAGCCTTTCTGCC

dpM3 109 R




AACCCCTTGACAGTTGTGGG

M3-109 b F

-1415

TTCCATCTCTACCCTCACCTTTG

M3-109 b R




GTAGGAGGAAAGGAATGGACCAT

dpM3 110 F

-837

GCCAGAGCTCCAAGGGTTTA

dpM3 110 R




GGCCTGTTGTGTATTGTTCGTGT

M3-110 b F

-237

AGCAGCCCACACCCTCTAGTT

M3-110 b R




CCAGGTCCAGCTTTGCCA

dpM3 Txn Start F

16

TGACCCCGGGAAAGAGGTAC

dpM3 Txn Start R




GATGCCTTCATGTCAGTGCCT

dpM3 111 F

526

GGTCTGGGCAAACAGTGGA

dpM3 111 R




TGACCTCCCAAGATCTCCCTC

dpM3 112 F

1827

TTCGGGATACCTATAAGATGGCA

dpM3 112 R




TTCAGAGCAAAACCCAAAACCTA

M3-112 b F

1212

ACATTAGCCTGTATAACCGTTTTCTGT

M3-112 b R




CTGATGTTACTTGATTACCTCTTGCTG

dpM3 113 F

2541

TGGTTATTTCTCACCCTTATGTGG

dpM3 113 R




GGGTTGATGCATTAAACCCTTG

dpM3-113b F

2818

CAAGGTGGCATTCAGATAACAACA

dpM3-113b R




AATCAAATTCTCCCCACAGATGA

dpM3 114 F

3397

AACCCCAGTTCCTGGTAGGG

dpM3 114 R




TCTCTGTTCCTCATAACTCTTGCTTG

dpM3-114b F

3736

TTCCTTGGATAATGATCACTCCTG

dpM3-114b R




AAAGCCATTTTGTCTTTAGCAATTG

M3-114 c F

3904

TTACATGTCCATCATTTAAAATACTGCC

M3-114 c R




GCATACCGTTGAAGGTGATGAGT

dpM3 +4400 A F

4299

AGCTGCTTACCCAGGAAGCC

dpM3 +4400 A R




TCATATTAATCAGCAAGGAAATCATGT

dpM3 +4400 B F

4234

TGGGATTTTCTGACTTGGCC

dpM3 +4400 B R




GCAGCTTTATTGAAAACACACATTG

dpM3-114-115 F

4110

CCTGCCTCTGGAAGATCTGTG

dpM3-114-115 R




CGGGCAAATATCCAGAGGG

dpM3-115 F

4517

GATTGGAGACCCCAGCTTCA

dpM3-115 R




CACCTTTGATTATGAGAAAGGGAAGA

dpM3-115b F

5005

TGTGATATTCATGTGCAAAGGAAA

dpM3-115b R




CAAATTGCCACTGGCCATTA

dpM3 116 F

5182

CAGTCCAGCCACAGTGGAACT

dpM3 116 R




CACATTCCCCACTGGCTTTG

dpM3-116b F

5921

GCCACGCTCTTCTGGTTACCT

dpM3-116b R




AGCTCAGGGAACCCCACAG

M3-116 c F

5574

TCCATTCTTCCCCACATCCA

M3-116 c R




CCAACCTATATGTTTGGGAGGC

dpM3 117 F

6273

TGTTCCACCATTACCTCAGCC

dpM3 117 R




CATCAACCCAGCCACAAAACT

M3-117 b F

6624

ATCCAGGCATCCTCCTTTGA

M3-117 b R




GGATAATCACTCTACAAACCACAGACC

dpM3 117-118 F

7110

TCTGCATCCTAGCCAGCATG

dpM3 117-118 R




TCCATACTACACCTGTCAGAATTGC

dpM3 118 F

7948

GGCAATTATTTATATGCTTACCTATTTCC

dpM3 118 R




TCCAGGCACACATTCTTTTCTTTA

dpM3 119 F

8850

TGGATGGACAAAGGTCTGAGC

dpM3 119 R




CATTCCATAAGAGCCCGGTCT

dpM3-120b F

10005

TTTGATGGTTTGAGGCCACA

dpM3-120b R




TCTTTGGCACCATTGGAACA

M3-120 c F

9186

GCAAGGAACTACATCTGGGCC

M3-120 c R




ACAAATCCCTTCCCTTCAAGTG

dpM3 121 F

10682

AATGGTGGTTGGCTGCTATCC

dpM3 121 R




ATTTTTCCAGTGGCTATGTGTGAG

M3-121 b F

11084

CAGCCAAGTTTCTCTTCTCCAGA

M3-121 b R




TGCTGTGGAAGATGGATCATG

dpM3-122b F

11311

TTCTTCACACTGAGAGTTATTTTGTGTC

dpM3-122b R




CCAAAGGTGCAAAGTAGAGCAGA

dpM3-122c F

11629

TGCCCCATAGATATAGCCTCAAA

dpM3-122c R




TCTCCTTTTCTCTCACTCCAAACA

M3-122 d F

11996

GCTGTTTTCCCTCCCTTTTCC

M3-122 d R




TTGCCAAGAAAAACACAATGTGTA

dpM3 123 F

12134

CAGCCAGTGCAGAGGGTTTAC

dpM3 123 R




GCCTTCCAAATCTTCTGGCA

dpM3 124 F

13245

ACCTGAGAGAGGAAGATTCTGTTTCT

dpM3 124 R




CCTAGGGTCTCCCCCATTGT

M3-124 b F

13643

GAGGGCACTGAGAACAAGGG

M3-124 b R




TTTGGTTTCTAGACAATCCTGGATTT

dpM3 125 F

14395

CAACAAAAACCAGGGAGGGTAC

dpM3 125 R




GTCAAGATGAGGGCTTTTCAATACA



D. Msc ChIP oligonucleotides

Name

Position

Sequence

dpMusc 34 F

-5769

TCCCCACCATCATTCTTGCT

dpMusc 34 R




CCCTTAGACGATGCCTGTGAA

dpMusc 35 F

-4827

CAAAGGCTGACTTGAACCTGG

dpMusc 35 R




CACAGGCTTACGTCCTTTTTGG

dpMusc 36 F

-3953

TGGACACGGACCTGGACTACT

dpMusc 36 R




GGCTACGTAAAAGACACCGCA

dpMusc 37 F

-2709

CCTACCTGTATCCAGCCTGGAA

dpMusc 37 R




AGTCAAAGTCTTGCTATATATCCCTGGT

dpMusc 38 F

-2236

GTGAAGAGGAACAAATGCTGGATA

dpMusc 38 R




TCTGCGTTCCATAGTAGTGAGCAG

dpMusc 39 F

-1379

TGGGAGGTATCGCCTTGAGA

dpMusc 39 R




TCATAGCAGGTGGCTGGCA

dpMusc 40 F

-391

CTGGGAGACAAGCCGCACT

dpMusc 40 R




CATTTTCACCTGCAGCTGGTC

dpMusc 41 F

1065

CAAACAAAAACTCAGTTGCCCA

dpMusc 41 R




GAAAGCAGCACTGGCGATTC

dpMusc 42 F

1638

TTCAGACGTGGCCATTCGT

dpMusc 42 R




CCTGTTGGCTGCAGAAACG

dpMusc 43 F

2956

AAGTCTGGTAAAGGTGAAACAATTGG

dpMusc 43 R




AGATGTGTTTGTATCCCACCCC

dpMusc 44 F

4000

CAAAAGGGAACCCAAAATGACTA

dpMusc 44 R




TTCAGACCTCACACCTGAATTACC

dpMusc 45 F

4901

TGAACTTAAAAAATAGTGTGCAGGCT

dpMusc 45 R




CCTCCTTTCAGTTGAGTTCAGCTT

dpMusc 46 F

5801

GAGTCACCCAGGCGGTACTG

dpMusc 46 R




TCACACTGCCAAGTCTCAAATGTT

dpMusc 47 F

7116

TGCTTATGTAGTCAGTAACACTGGAAAA

dpMusc 47 R




CCTAAGGCTTGCCCCTGC

dpMusc 48 F

7992

TTAAATTGCTGAATCTCTAGGGCA

dpMusc 48 R




TCATAGTGGCAAAGAAAGGACAACT

dpMusc 49 F

9225

AAAACAATTAGCACGGGAGCTC

dpMusc 49 R




AGCAATGATCTCACAGGCAGAG

dpMusc 50 F

9912

AGCTGTGCTCCACACTGTGC

dpMusc 50 R




TCCAGTCACATGCTGATGGC

Musc-32b F

-7169

CACCACTGCCTGGCTGCTA

Musc-32b R




TCTTCATAAAGTTTCATGGATGCC

Musc-32c F

-7496

AGCTTGATTGGCTTTCACACCT

Musc-32c R




TGGTAAGAGAGAAGAGAGGGACAGTC

Musc-32d F

-7894

TTGACCCAGTCTCAGGAAAACA

Musc-32d R




GGAAGGTACCATGGAGAGGCA

Musc-33b F

-6184

TGTTTCCAGACAACACAGGCA

Musc-33b R




GTCACTACCCAACCTACCTTTCACTAT

Musc-34b F

-5366

TGTCTTACACAAAGCCCAGGC

Musc-34b R




GCGTCGCAGCACCCAG

Musc-36b F

-3387

CCCCCTTTATGTCCAGTTTGG

Musc-36b R




CCCTCCCCCCACTACAAAA

Musc-38b F

-1960

CTGGGAGGAGAGGAGAAGGAG

Musc-38b R




AGCGCTGAGGATTAAGGCTG

Musc-39b F

-847

TTGGCAAGGCAACTGTGCT

Musc-39b R




GACTCAGACCCAACGCTTTGA

Musc-40b F

565

CGTGCTGAGCAAAGCCTTCT

Musc-40b R




TTGGAAAGCTTGGTGTCGG

Musc-42b F

2355

CCACCCACACTGTCCCCTAT

Musc-42b R




CTATGCTGTGGCAGGGTGAGA

Musc-42c F

2795

TCGCTATGTAAGCGCAGCC

Musc-42c R




GGTAATCCCAGCACTAACGGG

Musc-43c F

3254

GGGTAAGTCCTCCATCCCCA

Musc-43c R




CCTATAGCTTTATTCTACCGGCCAG



Share with your friends:


The database is protected by copyright ©dentisty.org 2019
send message

    Main page