Supplementary Materials and Methods Brain tissue processing



Download 17.4 Kb.
Date conversion28.05.2018
Size17.4 Kb.
Supplementary Materials and Methods
Brain tissue processing. Rats were euthanized by i.p injection of an overdose of sodium pentobarbitone. For immunohistochemistry and other histological analyses, rats were transcardially perfused with 100mL saline (0.9% w/v NaCl), followed by 50mL of 10% v/v buffered neutral formalin (Sigma Aldrich, St Louis, MO). Brains were removed and post-fixed overnight in 10% formalin, followed by cryoprotection in 30% sucrose in 1xPBS for 72 hours. Forty micron coronal sections from the entire striatum, globus pallidus and substantia nigra were cut using a cryostat (Leica Microsystems, Wetzlar, Germany) and collected in 1x PBS containing 0.4mg/mL methiolate and stored at 4C. For quantitative real-time PCR analysis, brains were removed rapidly and coronal brain tissue blocks including the striatum were immersed in RNALater solution (Qiagen, Germantown, MD) overnight at 4C and then stored at -20C until use. For western blot or AAV vector genomic PCR analyses, brains were removed rapidly and were snap-frozen and stored at -80C until use.
Immunohistochemistry. Immunohistochemistry was performed on free-floating brain sections as described previously [48]. Antibodies were diluted in 1x PBS containing 4% horse serum, 0.2% Triton-X100 and 0.4mg/mL methiolate. Ab1 rabbit anti-htt [49] (1:600, kind gift from Dr. Marian DiFiglia, Mass. General Hospital) or EM48 mouse anti-htt (1:1,000, MAB5374, Chemicon, Temecula, CA) were used to detect expression of AAV-HD70, -HD20 and -Hdh8. Antibodies used to detect markers for striatal neuronal cell populations were mouse anti-NeuN (1:1,000, MAB377, Chemicon), rabbit anti-calbindin-D28k (1:20,000, CB38, Swant, Bellinzona, Switzerland), rabbit anti-ChAT (1:1,000, AB143, Chemicon), rabbit anti-NPY (1:5,000, N9528, Sigma), mouse anti-parvalbumin (1:2,000, MAB1572, Chemicon) and rabbit anti-DARPP-32 (1:750, AB1656, Chemicon). Other antibodies used were mouse anti-GFAP (1:2,000, G3893, Sigma), mouse anti-enkephalin (1:1,000, MAB350, Chemicon), mouse anti-TH (1:1,000, MAB5280, Chemicon), and mouse anti-HuC/D (1:1,000, 16A11, Invitrogen). Sections were incubated overnight with primary antibodies. Sections were then incubated for 3 hours with biotinylated secondary antibodies (goat anti-mouse or goat anti-rabbit, 1:250, Sigma) followed by a 2-hour incubation with ExtrAvidin peroxidase (1:250, Sigma). Antibodies were visualized using 0.2mg/mL diaminobenzidine, 0.01% hydrogen peroxide in 0.1 M phosphate buffer. Negative controls were conducted for each antibody by omitting the primary antibody.
Anti-enkephalin immunostaining density analysis. Brains were analyzed from rats unilaterally injected with AAV-HD70, -HD20, -Hdh8, or -Empty vector (n=6), killed at 5 weeks post-injection. Four sections were selected from each brain, throughout the rostral-caudal extent of the globus pallidus and stained for enkephalin using DAB immunohistochemistry. Staining density was analyzed using Image-Pro Plus 5 (Media Cybernetics, Bethesda, MD). An estimate of enkephalin-positive projections to the globus pallidus in the injected hemisphere was calculated by dividing the density measured in the ipsilateral hemisphere by the density measured in the contralateral hemisphere.
Immunofluorescent double-labeling and confocal microscopy. Antibodies used to detect expression of AAV-HD70, -HD20 or -Hdh8 were Ab1 rabbit anti-htt or EM48 mouse anti-htt. Antibodies used to detect endogenous rat brain proteins were mouse anti-NeuN (1:1,000, Chemicon), goat anti-ChAT (1:1,000, AB144P, Chemicon), rabbit anti-NPY (1:5,000, Sigma), mouse anti-parvalbumin (1:2,000, Chemicon) and rabbit anti-DARRP-32 (1:750, Chemicon). For RNAi experiments, Ab1 rabbit anti-htt (1:600) was used to detect expression of huntingtin protein and hrGFP reporter gene expression was detected using native fluorescence. Four sections per brain were incubated overnight with primary antibodies. Sections were then incubated for 3 hours with donkey anti-mouse, anti-goat or anti-rabbit secondary antibodies conjugated to cy-2 or cy-3 (1:500, Jackson, West Grove, PA). Sections were then mounted onto glass slides and cover-slipped with anti-fade mounting medium (4% n-propyl gallate in 90% glycerol, 10% PBS). Also, immunofluorescent staining of striatal sections from animals injected with AAV-EGFP vector used antibodies against DARPP-32, NPY, parvalbumin and ChAT, combined with EGFP native fluorescence. Confocal microscopy was performed using a Leica TCS-SP2, with images collected at 63x magnification using FITC and TRITC filters.
Nissl staining. Sections were mounted onto glass slides in 1xPBS and dried overnight. Slides were immersed in 0.025% cresyl violet in 90mM acetic acid, 10mM sodium acetate for 3 hours, followed by dehydration in ascending ethanol and xylene, and cover-slipped with Cytoseal-60 mounting medium (Richard-Allan Scientific, Kalamazoo, MI).
Fluoro-Jade B staining. The anionic fluorochrome Fluoro-Jade B was used to stain degenerating neurons on brain sections. Briefly, brain sections were mounted onto glass slides in water and dried overnight. Slides were then immersed briefly in descending ethanol solutions followed by a 15-minute immersion in 0.06% potassium permanganate solution. Slides were washed briefly in water and then immersed in 0.001% Fluoro-Jade B solution (Chemicon) in 0.1% acetic acid for 30 minutes followed by dehydration and coverslipping.
PCR detection of virus genome in tissue samples. DNA was isolated from brain tissue samples from the striatum, substantia nigra and cerebellum according to the standard protocol from a DNeasy Tissue Kit (Qiagen). PCR was performed using the following primers that were designed to amplify a 120bp fragment in the WPRE region of the recombinant AAV1/2 vector genome: GGCTGTTGGGCACTGACAAT (forward), CCGAAGGGACGTAGCAGAA (reverse). The plasmid pAM/NSE-HD70-WPRE-BGH was used as a positive control. PCR products were separated on a 3% agarose gel.
Quantitative real-time RT-PCR analysis. Striatal tissue was removed from storage in RNAlater solution and RNA was prepared from 20-30mg striatal tissue using an RNeasy Mini kit (Qiagen), as per the manufacturers protocol and stored at -80C. DNA was removed from 500ng RNA aliquots using DNase I digestion. 100ng RNA was used for cDNA synthesis using Superscript II First Strand Synthesis System (Invitrogen), with random hexamer primers. RT- controls were prepared for every RNA sample by omitting to add reverse transcriptase. cDNA was stored at -20C. Quantitative real-time PCR was performed for RT+ and RT- cDNA samples using Platinum SYBR Green qPCR Supermix UDG with ROX (Invitrogen) and 300nm forward and reverse oligonucleotide DNA primers. No template controls were prepared by omitting to add cDNA template to the reaction. 10L reactions were performed in 384-well plates using an ABI 7900HT Sequence Detection System for Realtime PCR (Applied Biosystems). Oligonucleotide DNA primers were designed using Primer Express software (Applied Biosystems) to facilitate amplification of a 60bp amplicon from rat Hdh cDNA and human HD cDNA templates. These primers were degenerate at sites that varied between the rat and human sequence, two nucleotides within the forward primer and three within the reverse primer. The sequences of these primers were as follows: ATGGCRACCCTGGAAAARCTGATGA (forward) and YTGCTGCTGCAASGACTTGAGSGACTCGAA (reverse). Primers were also designed to amplify an 85bp amplicon from rat proenkephalin cDNA: gcagctgccttctttcaaaatc (forward), gtcgatgttatcccaagggaact (reverse); and an 85bp amplicon from rat DARPP-32 cDNA: aaggctggtctgtgtttgcttt (forward), tcccaccgggtaaatagaagaat (reverse). In addition, primers were designed to amplify four rat housekeeping gene cDNA sequences to facilitate normalization of expression data: GAPDH, catggccttccgtgttccta (forward), CCTGCTTCACCACCTTCTTGA (reverse); 18S rRNA, GGATCCATTGGAGGGCAAGT (forward), ACGAGCTTTTTAACTGCAGCAA (reverse); RPLPO, ATGGGCAAGAACACCATGATG (forward), CCTCCTTGGTGAACACAAAGC (reverse); PPIA, AGCCATGGAGCGTTTTGG (forward), GAGTTGTCCACAGTCGGAGATG (reverse). The sizes of amplicons generated using these primers were 118bp (GAPDH), 91bp (18s rRNA), 118bp (RPLPO), and 73bp (PPIA). Analysis of dissociation curves confirmed that single amplicon products were generated. Relative mRNA expression levels of htt constructs were calculated using the geNorm applet [50] for Microsoft Excel, normalized to the two most stable housekeeping genes.
Western blot quantification of protein expression. Co-transfected HEK293 cells harvested from 6-well plates or 20-30mg samples of fresh frozen striatal tissue were homogenized by sonication on ice in 50mM Tris-HCl, pH7.5, 2mM EDTA, 0.05% Triton-X100 with proteinase inhibitors (Complete Mini, Roche, Basel, Switzerland). Samples were denatured in sample buffer (5% w/v SDS, 10% v/v glycerol, 0.01% w/v bromophenol blue, 125mM Tris-HCl, pH6.8 and 10% v/v -mercaptoethanol) at 95C and 20g protein separated by 10% SDS-PAGE before transfer to Hybond-ECL nitrocellulose membranes (Amersham Biosciences, Piscataway, NJ). Membranes were incubated for 3 hours in a blocking buffer of 5% non-fat milk powder in Tris-buffered saline (Tris-HCl, 500mM NaCl, pH7.5) with 0.05% Tween 20 (TBST). After washing in TBST, membranes were incubated overnight at 4C with Ab1 rabbit anti-htt (1:600) or rabbit anti-GFP (1:5000, ab20, AbCam) in 1% non-fat milk powder in TBST. Membranes were then washed in TBST before incubating for 1 hour at 4C with peroxidase-conjugated goat anti-rabbit secondary antibody (1:5,000, sc-2004, Santa Cruz, Santa Cruz, CA). Membranes were washed in TBST and peroxidase-based detection was performed with enhanced chemiluminescence (ECL) detection reagent (Amersham Biosciences, Piscataway, NJ) followed by imaging (LAS-3000, Fujifilm, Tokyo, Japan) and quantification of protein bands (Multigauge V3.0, Fujifilm). To normalize protein bands to a gel loading control, membranes were washed in TBST and re-probed with mouse anti--actin (1:5,000, ab6276, AbCam) followed by incubation with peroxidase-conjugated goat anti-mouse (1:5,000, sc-2005, Santa Cruz) and ECL detection.
Statistical analysis. Data generated from stereological cell counts, immunostaining density quantification, western blots, RT-PCR and behavioral testing were subjected where appropriate to Student’s t-test or one-way ANOVA statistical analysis, with post-hoc analysis and Bonferroni correction of the significance level set at p<0.05, using SPSS v.11 (SPSS Inc., Chicago, IL). Data of experiment group meansSEM were graphed using Microsoft Excel (Microsoft Corporation, Redmond, WA).


The database is protected by copyright ©dentisty.org 2016
send message

    Main page