Probiotic composition based on the enterococcus strain and used as a treatment means and method for the production thereof



Download 5.58 Mb.
Page62/71
Date conversion29.11.2016
Size5.58 Mb.
1   ...   58   59   60   61   62   63   64   65   ...   71
The replicon present in pTN1 is unable to replicate in E. coli whereas replication in L. lactis is efficient. The ligatioin mixture was therefore transformed into L. lactis MG1363 and selected on M17 agar (Oxoid) with 5 g/L glucose and 5 g/mL of eryth- romycin. The resulting plasmid was named pPSM652.
Plasmid pPSM652 was isolated from L. lactis and electroporated into L. plantarum 299v using cells that have been made electrocompetent using a modified protocol developed by Wei et al (1995). Briefly, one mL of an overnight culture was diluted in fresh MRS broth (Oxoid) and grown until OD600 = 0.35. The culture was treated with 10 lig/mL ampicillin for 11/2 hours and washed twice in 40 mL ice-cold 5mM NaP-1mM MgCI2 buffer, pH 7.4. The cells were re-suspended in 500 lli 0.9 M su- crose-3mM MgCl2 buffer. 100 l electrocompetent cells and 1 jug ptasmid DNA were mixed in a 0.2 cm cuvette, left on ice for 2 min and electroporated using the follow- ing settings: 2.0 kV, 25 mF, 200 ohm. 900 l liquid MRS medium was added and the transformation mixture was incubated at 30 C for 21/2 hours. Transformed cells were

plated on MRS agar plates containing 3 sslg/mL of erythromycin and incubated for 48 hours at 30 C. Transformation of pPSM652 into L. plantarum 299v resulted in strain PSM2009.


Integration of pPSM652 into the chromosome of L. plantarum 299v.
To select for plasmid-carrying cells, strain PSM2009 was grown overnight in selec- tive medium at the permissive temperature (30 C). The overnight culture was diluted 1000 fold in fresh MRS medium and incubated overnight at 41 C. The overnight culture was diluted 104 and plated on MRS agar plates with antibiotic at the non- permissive temperature (41 C) for 48 hours to obtain single copy integrations of pPSM652 into the chromosome of L. plantarum 299v. Fig, 32 shows the strategy for pPSM652 integration. Erythromycin resistant clones were isolated and integration of plasmid pPSM652 was verified using the following primers hom2-thrB-5 (5' CGCGACCCTGCTTGATCCGTCC 3') (SEQ ID NO : 54) and pTN1-frw (5'GGAA- CAGAACATTTTTTTGTTAAGA 3'). The primer sequence of hom2-thrB-5 is not included in the fragment that was inserted in pPSM652, but located in a position on the chromosome of 299v, which is further upstream of the sequence in pPSM652.
Consequently, only erythromycin resistant clones that contain an integrated plasmid pPSM652 will give rise to a PCR product. One such clone containing pPSM652 on the chromosome was named PSM2011.
Excision of plasmid pPSM652 in PSM2011 by a second single-crossover event is allowed by growth in non-selective MRS broth at the permissive temperature (30 C).
PSM2011 was incubated in MRS broth at 30 C overnight and diluted to 10-3 in fresh medium. The overnight incubation and dilution was repeated three times and cells were spread on MRS agar plates and incubated at 30 C for two days. By replica- plating to MRS agar plates containing erythromycin, clones that were unable to grow in the presence of erythromycin were identified. These clones were expected to have excised the integrated pPSM652 plasmid. The single-crossover event will result either in a mutant strain or a wild-type strain depending on how the recombi- nation takes place. The two types of events can be distinguished using the primers hom2-thrB-5 and hom2-thrB-4. Wild type clones will result in a 1908 bp PCR frag- ment, whereas mutant clones will result in a 1509 bp PCR fragment. A mutant clone was isolated and named PSM2012.

The presence of an internal 399 bp deletion in the hom2-thrB genes of strain PSM2012 was verified by Southern blot analysis. Genomic DNA was prepared from strains PSM2012 and L. plantarum 299v. Isolated genomic DNA from both strains was digested with either Hincil or Accl and separated on a 1% agarose gel. The agarose gel was treated for hybridisation as described previously (Arnau et al. ; 1996) followed by transfer of the DNA to a Hybond-N+ membrane (Amersham Bio- sciences). The membrane was hybridised using a-1000 bp hom2-thrB fragment, amplified from genomic DNA by using the primers hom2-thrB-5 and hom2-thrB-2, as probe. Probe labeling was performed using Ready-To-Go DNA labeling beads (Amersham Biosciences). Unincorporated nucleotides were removed using a NICK column (Amersham Biosciences). The Southern blot analysis is shown in Fig. 33.


The Southern blot analysis revealed two bands of approximately 1.1 kb and 1. 8 kb, respectively, when L. plantarum 299v genomic DNA was digested with Accl and hybridised with the hom2-thrB probe. In contrast, genomic DNA isolated from PSM2012 digested with Acci and hybridised with the same probe resulted in bands of approximately 0.7 kb and 1. 8 kb, respectively. Based on available genome se- quence from L. plantarum WCFS1, the wild type strain (299v) was expected to give rise to fragments of 1038 and > 730 bp, respectively, whereas the deletion strain (PSM2012) was expected to give rise to fragments of 639 and > 730 bp, respec- tively, when digested with Accl. Thus, the sizes of the fragments revealed by South- ern hybridisation correspond the expected sizes of the smallest fragment for both the wild type and the deletion strain and further indicate the presence of an Acci site 1.8 kb upstream of the Acci site located in the probe sequence.
The Southern blot analysis revealed two bands of approximately 0.9 kb and 1. 5 kb, respectively, when L. plantarum 299v genomic DNA was digested with Hincll and hybridised with the hom2-thrB probe. In contrast, genomic DNA isolated from PSM2012 digested with Hincil and hybridised with the same probe resulted in a band of approximately 1.3 kb. Based on available genome sequence from L. plan- tarum WCFS1, the wild type strain (299v) was expected to give rise to fragments of 826 and > 747 bp, respectively, whereas the deletion strain (PSM2012) was ex- pected to give rise to fragments of 1204 bp and > 747 bp, respectively, when di- gested with Hincll. Thus, the smallest fragments revealed by Southern hybridisation when wild type DNA was digested with Hincll correspond to the expected 826 bp

fragment and the largest band indicate the presence of an Hincil site approximately 1.3 kb upstream of the Hincil site located in the probe sequence. For the deletion strain, a band of 1206 bp was expected predicted from the genome sequence and a band of 1.3 kb was expected from the hybridisation pattern observed for the wild type strain. Thus, we assume that the observed band of approximately 1.3 kb represents a double band. In summary, the Southern blot analysis of chromosomal DNA from PSM2012 resulted in the hybridisation pattern expected for a deletion strain.


L. plantarum strains 299v and PSM2012 were inoculated in defined medium with out threonine and as a control in the same medium supplemented with threonine (Lbp- V24-G10). The medium components are listed in the box below.
The wild type strain (299v) was able to grow in both media. In contrast, the deletion strain (PSM2012) was unable to grow in the threonine deficient medium, but able to grow in the same medium supplemented with threonine indicating a block in the threonine biosynthetic pathway.
In summary, this example shows that specific gene inactivation can be achieved in L. plan : arum by use of plasmid pTN1.
The chemically defined medium Lbp-V24-G10 for L. plantarum contains: Carbohydrate : 10 g/L D-Glucose ; Buffers :, 3.6 g/L sodium acetate, 3 g/L potassium dihydrogen phosphate, 3 g/L dipotassium hydrogen phosphate ; Fatty acid ester : 1 mL/L Tween 80 ; Amino acids : 1.2 g/L L-alanine, 0. 8 g/L L-arginine, 0.4 g/L L-asparagine, 0.2 g/L L-cysteine, 1.2 g/L glutamic acid, 0.4 g/L glutamin, 0. 8 g/L glycine, 0.2 g/L L-histidine, 0.4 g/L L- isoleucine, 0.4 g/L L-leucine, 1.0 g/L L-lysine-HCI, 0.4 g/L L-methionine, 0.8 g/L L- phenylalanine, 1.2 g/L L-proline, 1.2 g/L L-serine, 0.8 g/L L-threonine, 0.1 g/L L-tryptophane, 0.2 g/L L-tyrosine, and 0.4 g/L L-valine ; Nucleotide bases and vitamins: 0.05 g/L adenine, 0.05 g/L guanine, 0.05 g/L xanthine, 0.05 g/L uracil, 0.2 mg/L potassium p-aminobenzoate, 0.05 mg/L biotin, 0.05 mg/L cyanocobala- min, 1 mg/L riboflavin, 1 mg/L nicotinic acid, 1 mg/L niacinamid, 0.05 mg/L folic acid, 2 mg/L pyridoxal-HCI, 2 mg/L pyridoxin-HCI, 1 mg/L thiamin-HCI, 0.1 mg/L lipoic acid, 5 mg/L inos- ine, 3.7 mg/L thymidine, and 5 mg/L potassium orotate; Mineral salts with complexing agent : 0.5 g/L magnesium sulphate heptahydrate, 0.05 g/L manganese sulphate hydrate, 0.02 g/L iron (li) sulphate heptahydrate; 3 uM ammonium molybdat tetrahydrate, 0.4 mM boric acid, 30 uM cobalt chloride hexahydrate, 10 uM cupric sulphate pentahydrate, 80 uM manganese chloride tetrahydrate, 10 uM zinc sulfate hepta- hydrate, 1 g/L diammonium hydrogen citrate, and 19 mg/L citric acid.

Example 21: Immunomodulatory effects The present example illustrates various methods for analysing the immunomodula- tory effects of pure polypeptides with or without the parallel use of probiotic strains, which are e. g. wild type optimised for selected probiotics properties, null-mutants, secretion deficient mutants, or modification deficient mutants.


The identified genes encoding Enolase, GAPDH, PGK and TPI (in the following termed GENE PRODUCTS) will each be inserted into expression vectors for lactic acid bacteria but also into expression vectors for other bacteria such as E. coli (as in example 10). The resulting vectors will be introduced into appropriate strains, which then will be grown under controlled conditions in fermentors (Bredmose et al. ; 2001).
A pure preparation of GENE PRODUCTS can be obtained using the above tech- niques followed by standard purification techniques. It should be noted that the secretion, localisation on the cell surface, and/or possibly chemical modifications could be imperative for the GENE PRODUCTS to be capable of exerting immuno- modulation, or changing the amount and/or composition of the mucins in animals or humans. This analysis will be carried out according to the description below where the application of a probiotic strain includes the use of a null-mutant with respect to the gene or genes encoding the relevant GENE PRODUCT (S), or a mutant that is deficient in the ability to secrete the GENE PRODUCT (S), such as the 299v mutant 149-D7 described in examples 14-15, or a mutant deficient in the ability to perform a chemical or structural modification critical for the function of the GENE PROD- UCT (S).
Pure preparations of one or more GENE PRODUCTS can be used alone or in com- bination with probiotic strains in the developed in vitro assays (example 13) aiming at testing and establishing the immunomodulatory properties of GENE PRODUCTS alone or in combination with probiotic strains and derivatives thereof, such as e. g. the mutagenised strain 149-D7. The probiotic strains could be wild type, naturally improved or improved using recombinant gene technology techniques as described in the following example. Immunomodulatory effects means that the production increases or decreases of one or more of either the cytokines IL1, IL2 etc. to IL15, TNF-alpha, TGF-beta, interferons and mucins compared to neutral control- compounds and strains. These effects can be studied in the developed dendrite cell assay described in example 13. If one or more of the GENE PRODUCTS alone or in

any combination with or without probiotic strains or derivatives thereof show immunomodulatory effects in the in vitro assay, they can be used in animal models or in human trials.


The animal models could include a colitis model where the intestines of animals are treated with dextran sulfate sodium (Okayasu et al. ; 1990) to induce colitis symptoms. Following induction, the animals are nourished with feed containing the compound (s) and or the strains to be tested. Also, a control with no compound (s) or strains is included. The animals are killed after an appropriate time of treatment and their intestines will be examined. In addition, an analysis of the levels of selected markers such as cytokines could be carried out. Moreover, an analysis of the mucin production and composition before and after the treatment could be performed. Subsequently, human trials will be carried out if the examination and/or the levels of markers show that the compounds and/or the bacterial strains demonstrate the expected beneficial effects.
The human trials will be carried out in patients with e. g. autoimmune diseases, including, but not limited to, Inflammatory Bowel Disease or rheumatoid arthritis. The compound (s) with or without probiotic strain (s) and/or supporting compounds could be encapsulated using an appropriated substance that releases the contents at desired locations in the intestine. Examination of symptoms and analysis of relevant marker such as TNF-alpha and other cytokines wiii be performed. A ! so, an analysis of the mucin production and composition before and after the treatment is relevant.
Novel drugs will result from the above program. The drugs can either be used alone or in combination with existing drugs to treat or prevent several diseases including autoimmune diseases, cancers and microbial infections.
Example 22: Selected applications of the present invention The present invention in preferred embodiments is directed to e. g. methods for developing or constructing probiotic strains with impaired or improved probiotic properties, methods for setting up a quality control in the manufacturing process of probiotic starter cultures and end-user products, and methods for screening for new probiotic strains, as described in more detail herein below.

Improved probiotic strains can be developed when the GENE PRODUCTS alone or on the surface of a probiotic microorganism have been demonstrated to exert immunomodulatory effects or alterations in the mucin production in in vitro assays and/or in animals and/or in humans. Two approaches can be used namely i) traditional mutagenesis followed by screening procedures and ii) the use of recombinant gene technology to enhance or reduce the levels of the GENE PRODUCTS.


The first approach uses EMS (ethyl-methane-sulfonate), as described in example 14, or UV irradiation for the mutagenesis of a known probiotic strain such as L. plantarum 299v. A large number, preferably but not restricted to more than 104, of mutagenised bacteria will subsequently be analysed using a high throughput screening (HTS) technology, as described in example 14. The HTS is based on growth of the lactic acid bacterium mutants in microtiter wells followed by the monitoring of the levels of one or more GENE PRODUCTS. Preferred mutants could overproduce one or more GENE PRODUCTS and/or have a lower production of one or more other GENE PRODUCTS and/or a have a higher or lower production of any other metabolic products produced by the bacterium. However, mutants that do not contain one or more GENE PRODUCTS on the surface will be useful for analysing the importance of the GENE PRODUCTS on the surface of Lactobacillus and/or the role of a possible modification of the GENE PRODUCTS. Enzyme activity assays or specific antibodies could be used for the quantification of the production levels of the GENE PRODUCTS or any other metabolic product produced by the bacterium.
The preferred mutants will be analysed in in vitro assays (as in example 13) and animal models as described in the former example. The GENE PRODUCTS or any other supporting compounds could be included together with the mutants in the analysis. Mutants that show the expected effects alone or in any combination with GENE PRODUCTS or any other supporting compounds will be used in human trials also as described in the former example.
In the second approach, one or more genes encoding the GENE PRODUCTS will be inserted into an appropriate expression vector such as pVS2 (von Wright et al. ; 1987) containing expression signals that ensure the desired production levels of the GENE PRODUCTS. Expression signals include promoters, Shine Dalgarno sequences (RBS-sequences), secretion signals and the modulation of the distances

between these units themselves and the distances to the start codon of the gene (s).


Also, one or more genes encoding the GENE PRODUCTS together with the appro- priate expression signals could be inserted into the chromosome of the bacterium using the described techniques (Madsen et al. ; 1996). Moreover, null-mutants con- taining a deletion in one or more genes encoding the GENE PRODUCTS can be constructed using for instance gene replacement techniques (Madsen et al. ; 1996), as described in example 20. Also, it will be possible to construct strains that are deficient in the secretion of one or more of the GENE PRODUCTS. This will be done using an approach that allows the generation of randomly located and tagged inser- tions into the genome of Lactobacillus followed by screenings according to the description above. The construction of null-mutants requires the use of growth me- dia containing compounds that replace the metabolic products produced in the reactions catalysed by the GENE PRODUCTS in the wild type. The use of the null- mutants or the secretion deficient mutants in the analysis will provide evidence whether secretion, surface localisation and/or possibly chemical modifications are imperative for the GENE PRODUCTS to be capable of exerting immunomodulations or changing the levels and the composition of the mucins in animals or humans.
The resulting recombinant strains will be analysed for the expected over-production and/or lowered production of the GENE PRODUCTS and possibly also other meta- bolic compounds produced by the bacterium. Analyses of increased or decreased secretion of GENE PRODUCTS as well as analyses of the modification of the GENE PRODUCTS can also be performed.
The analysis could be carried out using the same methods as described above for the HTS technique. The recombinant strains will be analysed in in vitro assays and in animal models as described above for the preferred mutant. Also as described for the preferred mutants, the recombinant strains could also be tested in humans.
Quality control (QC) in the manufacturing process of probiotic starter cultures and probiotic end-user products can be established when the GENE PRODUCTS have been demonstrated to exert immunomodulatory effects or alterations in the mucin production in in vitro assays and/or in animals and/or in humans.

Starter culture companies can perform QC on probiotic cultures in the laboratory and in the manufacturing process using methods that take advantage of the GENE PRODUCTS as probiotic markers. Analysing for appropriate levels of the GENE PRODUCTS in the probiotic starter can be performed during inoculation, propaga- tion and the manufacturing of the cultures. The analysis can include monitoring of the levels of one or more GENE PRODUCTS, the presence of the genes encoding one or more GENE PRODUCTS and/or the levels of mRNA related to the genes encoding one or more GENE PRODUCTS. The companies that produce end-user probiotic products can perform the same QC by using the same techniques.-Also, these techniques can be used for process optimisations in the production of probi- otic starter cultures and/or end-user probiotic products, c. f. the different GAPDH activities at different growth stages and conditions as shown e. g. in Example 9.


Moreover, these techniques are useful for the identification of and screening for new probiotic strains that could be found anywhere in the environment such as in the Gi- tract of humans or animals, in dairy products and in cereals. The screening could be performed using the HTS technology described above.
References

1. a : Glenn, M., Havukkala, I. J. , Bloksberg, Lubbers M. W. , Dekker, J. , Chris- l : ensson, A. C., Holland, R., OrToole, P. W., Reid, J. R., and Coo) bear, T. Lac- tobacillus Rhamnosus Polynucleotides, Polypeptides and Methods for Using

Them. United States Patent Publication. 31-10-2002. Ref Type : Patent

2. Adlerberth, I., S. Ahrne, M. L. Johansson, G. Molin, L. A. Hanson, and A. E.


Wold. 1996. A mannose-specific adherence mechanism in Lactobacillus plan- tarum conferring binding to the human colonic cell line HT-29. Appl. Environ.
Microbiol. 62: 2244-2251.
3. Arnau, J., K. l. Srensen, K. F. Appel, F. K. Vogensen, and K. Hammer. 1996.
Analysis of heat shock gene expression in Lactococcus lactis MG1363. Micro- biology 142: 1685-1691.

4. b: Glenn, M. , Lubbers, M. , and Dekker, J. Polynucleotides, Materials Incorpo- rating Them, and Methods for Using Them. [US 6,476, 209]. 5-11-2002.

* Ref Type: Patent 5. Barea, P. L., E. Calvo, J. A. Rodriguez, A. Rementeria, R. Calcedo, M. J.
Sevilla, J. Ponton, and F. L. Hernando. 1999. Characterization of Candida al- bicans antigenic determinants by two-dimensional polyacrylamide gel electro- phoresis and enhanced chemiluminescence. FEMS Immunol. Med. Microbiol.
23: 343-354.
6. Bergmann, S. , M. Rohde, G. S. Chhatwal, and S. Hammerschmidt. 2001. al- pha-Enolase of Streptococcus pneumoniae is a plasmin (ogen) -binding protein displayed on the bacterial cell surface. Mol. Microbiol. 40: 1273-1287.
7. Bernard, N., K. Johnsen, T. Ferain, D. Garmyn, P. Hols, J. J. Holbrook, and J.
Delcour. 1994. NAD (+) -dependent D-2-hydroxyisocaproate dehydrogenase of

Lactobacillus delbrueckii subsp. bulgaricus. Gene cloning and enzyme char- acterization. Eur. J. Biochem. 224 : 439-446.


8. Bredmose L. , M. SM. V. A. R. P. J. MG. G. J. Es. l. H. 2001. Development of a heterologous gene expression system for use in Lactococcus lactis. A novel gram-positive expression system. Recombinant Protein Production with Pro- karyotic and Eukaryotic Cells-A Comparative View on Host Physiology.
9. Christensen, H. R. , H. Frokiaer, and J. J. Pestka. 2002. Lactobacilli differen- tially modulate expression of cytokines and maturation surface markers in murine dendritic cells. J. Immunol. 168: 171-178.
10. Colins, J. K. and O'Mahoney, L. In Vitro Model For Gastrointestinal Inflamma- tion. WO 00/42429. 20-7-2000.
11. De Man, J. C, . M. Rogosa, and. M. E. Sharpe. 1960. A medium for the cultiva- tion of Lactobacilli. J. Appl. Bact 23: 130-135.
12. Gil-Navarro, I., M. L. Gil, M. Casanova, J. E. O'Connor, J. P. Martinez, and D.
Gozalbo. 1997. The glycolytic enzyme glyceraldehyde-3-phosphate dehydro- genase of Candida albicans is a surface antigen. J. Bacteriol. 179: 4992-4999.

13. Granato, D. , F. Perotti, I. Masserey, M. Rouvet, M. Golliard, A. Servin, and D.


Brassart. 1999. Cell surface-associated lipoteichoic acid acts as an adhesion factor for attachment of Lactobacillus johnsonii La1 to human enterocyte-like

Caco-2 cells. Appl. Environ. Microbiol. 65: 1071-1077.


14. Grifantini, R. , E. Bartolini, A. Muzzi, M. Draghi, E. Frigimelica, J. Berger, F.
Randazzo, and G. Grandi. 2002. Gene Expression Profile in Neisseria menin- gitidis and Neisseria lactamica upon Host-Cell Contact: From Basic Research to Vaccine Development. Ann. N. Y. Acad. Sci. 975: 202-216.
15. Hanage, W. P. and J. Cohen. 2002. Stimulation of cytokine release and adhe- sion molecule expression by products of Viridans streptococci. J. Infect. Dis.
185: 357-367.
16. Hart, A. L., A. J. Stagg, and M. A. Kamm. 2003. Use of probiotics in the treat- ment of inflammatory bowel disease. J. Clin. Gastroenterol. 36: 111-119.
17. Huther, F. J., N. Psarros, and H. Duschner. 1990. Isolation, characterization, and inhibition kinetics of enolase from Streptococcus rattus FA-1. Infect. Im- mun. 58 : 1043-1047.
18. Ibrahim, S. A. , and D. J. O'Sullivan. 2000. Use of chemical mutagenesis for the isolation of food grade beta-galactosidase overproducing mutants of bifido- bacteria, lactobacilli and Streptococcus thermo, ohilus. J. Dairy Sci. 83 : 923-930.
19. Kazmi, S. U., R. Kansal, R. K. Aziz, M. Hooshdaran, A. Norrby-Teglund, D. E.
Low, A. B. Halim, and M. Kotb. 2001. Reciprocal, temporal expression of SpeA and SpeB by invasive M1T1 group a streptococcal isolates in vivo. Infect. Im- mun. 69: 4988-4995.
20. Kleerebezem, M. , J. Boekhorst, R. Van Kranenburg, D. Molenaar, O. P.
Kuipers, R. Leer, R. Tarchini, S. A. Peters, H. M. Sandbrink, M. W. Fiers, W.
Stiekema, R. M. Lankhorst, P. A. Bron, S. M. Hoffer, M. N. Groot, R. Kerkho- ven, M. De Vries, B. Ursing, W. M. De Vos, and R. J. Siezen. 2003. Complete genome sequence of Lactobacillus plantarum WCFS1. Proc. Natl. Acad. Sci.
U. S. A 100: 1990-1995.

21. Kussmann, M. , U. Lassing, C. A. Sturmer, M. Przybylski, and P. Roepstorff.


1997. Matrix-assisted laser desorption/ionization mass spectrometric peptide mapping of the neural cell adhesion protein neurolin purified by sodium dode- cyl sulfate polyacrylamide gel electrophoresis or acidic precipitation. J. Mass

Spectrom. 32: 483-493.


22. Liaudet, L., C. Szabo, O. V. Evgenov, K. G. Murthy, P. Pacher, L. Virag, J. G.
Mabley, A. Marton, F. G. Soriano, M. Y. Kirov, L. J. Bjertnaes, and A. L.
Salzman. 2003. Flagellin from Gram-negative bacteria is a potent mediator of acute pulmonary inflammation in sepsis. Shock 19: 131-137.
23. Maassen, C. B. , C. Holten-Neelen, F. Balk, M. J. Bak-Glashouwer, R. J. Leer,

J. D. Laman, W. J. Boersma, and E. Claassen. 2000. Strain-dependent induc- tion of cytokine profiles in the gut by orally administered Lactobacillus strains.


Vaccine 18: 2613-2623.
24. Mack, D. R., S. Michail, S. Wei, L. McDougall, and M. A. Hollingsworth. 1999.
Probiotics inhibit enteropathogenic E. coli adherence in vitro by inducing intes- tinal mucin gene expression. Am. J. Physiol 276 : G941-G950.
25. Madsen, S. M. , B. Albrechtsen, E. B. Hansen, and H. Israelsen. 1996. Cloning and transcriptional analysis of two threonine biosynthetic genes from Lacto- coccus lactis MG1614. J. Bacteriol. 178 : 3689-3694.
26. Mattar, A. F. , D. H. Teitelbaum, R. A. Drongowski, F. Yongyi, C. M. Harmon, and A. G. Coran. 2002. Probiotics up-regulate MUC-2 mucin gene expression in a Caco-2 cell-culture model. Pediatr. Surg. Int. 18 : 586-590.
27. Neu T. , and B. Henrich. 2003. New thermosensitive delivery vector and its use to enable nisin-controlled gene expression in Lactobacillus gasseri. Appl. Envi- ron. Microbiol. 69: 1377-1382.
28. Neurath, M. F. , S. Finotto, and L. H. Glimcher. 2002. The role of Th1/Th2 po- larization in mucosal immunity. Nat. Med. 8: 567-573.
29. Ochman, H. , A. S. Gerber, and D. L. Hartl. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120: 621-623.

30. Ochman, H. , A. S. Gerber, and D. L. Hart). 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120 : 621-623.


31. Okayasu, I., S. Hatakeyama, M. Yamada, T. Ohkusa, Y. Inagaki, and R. Na- kaya. 1990. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 98: 694-702.
32. O'Sullivan, D. J. , and T. R. Klaenhammer. 1993. High-and low-copy-number

Lactococcus shuttle cloning vectors with features for clone screening. Gene

137: 227-231.
33. Pancholi, V. and V. A. Fischetti. 1992. A major surface protein on group A streptococci is a glyceraldehyde-3-phosphate-dehydrogenase with multiple binding activity. J. Exp. Med. 176: 415-426.
34. Pancholi, V. and V. A. Fischetti. 1993. Glyceraldehyde-3-phosphate dehydro- genase on the surface of group A streptococci is also an ADP-ribosylating en- zyme. Proc. Natl. Acad. Sci. U. S. A 90: 8154-8158.
35. Pancholi, V. and V. A. Fischetti. 1997. Regulation of the phosphorylation of human pharyngeal cell proteins by group A streptococcal surface dehydroge- nase: signal transduction between streptococci and pharyngal cells. J. Exp.
Med. 186 : 1633-1643.
36. Pancholi, V. and V. A. Fischetti. 1997. A novel plasminogen/plasmin binding protein on the surface of group A streptococci. Adv. Exp. Med. Biol. 418 : 597-

599.
37. Pancholi, V. and V. A. Fischetti. 1998. alpha-enolase, a novel strong plas- min (ogen) binding protein on the surface of pathogenic streptococci. J. Biol.


Chem. 273: 14503-14515.
38. Sanders, M. E. 2003. Probiotics. Food Technology 53: 67-77.
39. Sen, S. , M. M. Mullan, T. J. Parker, J. T. Woolner, S. A. Tarry, and J. O.
Hunter. 2002. Effect of Lactobacillus plantarum 299v on colonic fermentation and symptoms of irritable bowel syndrome. Dig. Dis. Sci. 47: 2615-2620.

40. Shevchenko, A. , M. Wilm, O. Worm, and M. Mann. 1996. Mass spectrometric sequencing of proteins from silver-stained polyacrylamide gels. Anal Chem.


68: 850-858.
41. Vidal, K. , A. Donnet-Hughes, and D. Granato. 2002. Lipoteichoic acids from

Lactobacillus johnsonii strain La1 and Lactobacillus acidophilus strain La10 antagonize the responsiveness of human intestinal epithelial HT29 cells to lipopolysaccharide and gram-negative bacteria. Infect. Immun. 70: 2057-2064.


42. Von Wright, A. , S. Tynkynnen, and M. Suominen. 1987. Cloning of a Strepto- coccus lactis subsp. lactis chromosomal fragment associated with the ability to grow in milk. Appl. Environ. Microbiol. 53: 1584-1588.
43. Wei. M. Q. , C. M. Rush, J. M. Norman, L. M. Hafner, R. J Epping, and P. Timms.
1995. An improved method for the transformation of Lactobacillus strains using electroporation. J. Microbiol. Methods. 21: 97-109.
44. Wolff, A. M. and J. Arnau. 2002. Cloning of glyceraldehyde-3-phosphate dehy- drogenase-encoding genes in Mucor circinelloides (Syn. racemosus) and use of the gpd1 promoter for recombinant protein production. Fungal. Genet. Biol.
35: 21-29.
45. Zhang, J. P. and S. Normark. 1996. induction of gene expression in Escher- ichia coli after pilus-mediated adherence. Science 273 : 1234-1236.
46. Johansson M.-L., G. molin, B. Jeppson, S. Nobaek, S. Ahrne and S. Beng- mark. 1993. Administration of different Lactobacillus strains in fermented oat- meal soup: in vivo colonization of human intestinal mucosa and effect on in- digenous flora. Appl. Environmental. Micobiol. 59: 15-20.
47. Ahrne S. , S. Nobaek, B. Jeppson, I. Adlerbreth, A. Wold and G. Molin. 1998.
The normal Lactobacillus flora of healthy human rectal and oral mucosa. J.
Appl. Microbiol. 85: 88-94.
48. Molin G. , B. Jeppson, S. Ahrne, M. -L. Johansson, S. Nobaek, M. Stahl and S.
Bengmark. 1993. Numerical taxonomy of Lactobacillus spp. associated with healthy and diseased mucosa of the human intestines. J. Appl. Microbiol.
74: 314-323.

49. Hessle, C. , L. A. Hansson, and A. E. Wold. 1999. Lactobacilli from human gas- trointestinal mucosa are strong stimulators of IL-12 production. Clin Exp Im- munol. 116: 276-282.


50. Antonsson M. 2001. Lactobacillus in semi-hard cheese and their use as ad- junct cultures. Doctoral Thesis. Lund University. ISBN : 91-7874-139-4.
51. Cunningham-Rundles, S. , S. Ahrne, and S. Bengmark. 2000. Probiotics and immune respons. Am. J. Gastroenterol. 95: S22-S25.
52. Cunningham-Rundles, S. , S. Ahrne, B. S. Abuav-Nissbaum, and A. Dnistrian.
Development of immunocompetence: role of micronutrients and micoorgan- isms. Nutr. Rev. 60: S68-S72.Claims:

Patent Claims 1. A microbial cell comprising at least one microbial cell surface polypeptide and a substantially identical intracellular equivalent thereof, wherein the microbial cell is selected from the group consisting of Lactobacillus species and Bifidobacterium species, and wherein the microbial cell comprises an altered polynucleotide sequence as compared to a reference microbial cell comprising a reference polynucleotide sequence without said alteration, wherein the activity of the intracellular equivalent is capable of converting a substrate in a Lactobacillus metabolic pathway and/or a Bifidobacterium metabolic pathway, and wherein the altered polynucleotide sequence results in an altered, preferably increased, production and/or secretion and/or post-translational modification in the microbial cell of the at least one microbial cell surface polypeptide as compared to the production and/or secretion and/or post-translational modification of the cell surface polypeptide in a reference microbial cell comprising said reference polynucleotide sequence without said alteration.


2. The microbial cell of claim 1, wherein the alteration in the polynucleotide sequence is a change in a gene encoding a trans-acting factor or in a region capable of controlling the expression of said gene, wherein said trans-acting factor is a polypeptide that alters, preferably increases, the production and/or secretion and/or post-translational modification of the at least one microbial cell surface polypeptide.
3. The microbial cell of claim 2, wherein the trans-acting factor is a regulator, such as a repressor or transcriptional activator of the gene encoding the at least one microbial cell surface polypeptide.

4. The microbial cell of claim 2, wherein the trans-acting factor is a polypeptide required for cell surface localisation of the at least one microbial cell surface polypeptide.


5. The microbial cell of claim 2, wherein the trans-acting factor is a polypeptide required for post-translational modification of the at least one microbial cell surface polypeptide.
6. The microbial cell of claim 5, wherein said post-translational modification is a deamidation.
7. The microbial cell of claim 1, wherein the at least one microbial cell surface polypeptide is encoded by a first polynucleotide operably linked to a second polynucleotide capable of directing the expression of said first polynucleotide, and wherein the alteration in the polynucleotide sequence results in the first and second polynucleotides not being natively associated, and wherein said reference microbial cell polypeptide comprises the first polynucleotide operably linked to its native expression signal.
8. The microbial cell of claim 7, wherein the second polynucleotide has more than

90% sequence identity to the reference second polynucleotide that is natively associated with the first polynucleotide.


9. The microbial cell of claim 7, wherein the second polynucleotide has less than

90% sequence identity, such as less than 75%, e. g. less than 50%, such as less than 30% sequence identity to the reference second polynucleotide that is natively associated with the first polynucleotide.


10. The microbial cell of any of claims 7 to 9, wherein said reference second polynucleotide consists of the 1000 contiguous nucleotides preceding the translation start in the operon encoding the at least one microbial cell surface polypeptide.
11. The microbial cell of any of the preceding claims, wherein said reference microbial cell is Lactobacillus plantarum 299v.

12. The microbial cell of any of the preceding claims, wherein the genetic material of said microbial cell and that of said reference microbial cell differ only in said alteration.


13. The microbial cell of any of claims 1 to 11, wherein the genetic material of said microbial cell and that of said reference microbial cell differ in less than 10000, such as less than 1000, e. g. less than 100, such as less than 10, such as less than 2 nucleotides in addition to said alteration.
14. The microbial cell of any of the preceding claims, wherein said alteration is a deletion, substitution or insertion of a single nucleotide.
15. The microbial cell of any of claims 1 to 13, wherein said alteration is an insertion, substitution or insertion of more than one nucleotide, such as more than 2, e. g. more than 5, such as more than 10, e. g. more than 50, such as more than 100 nucleotides.
16. The microbial cell of any of the preceding claims, wherein the intracellular equivalent of the microbial cell surface polypeptide is selected from the group consisting of Lactobacillus enzymes acting in a metabolic pathway.
17. The microbial cell of any of claims 1 to 10 or any of claims 12 to 15, wherein the intracellular equivalent of the microbial cell surface polypeptide is selected from the group consisting of Bifidobacterium enzymes acting in a metabolic pathway.
18. The microbial cell according to claim 16 or 17, wherein the metabolic pathway is selected from the glycolytic pathway and the phosphotransferase system.
19. The microbial cell according to claim 16 or 17, wherein the enzyme is selected from the group consisting of hexokinase; glucose 6-phosphate isomerase; phosphofructokinase; aldolase ; triose phosphate isomerase (TPI) ; glyceraldehyde 3-phosphate dehydrogenase (GAPDH); phosphoglycerate kinase (PGK); phosphoglycerate mutase; enolase ; and pyruvate kinase.

20. The microbial cell according to any of claims 2 to 19, wherein the enzyme is selected from the group consisting of enolase ; glyceraldehyde 3-phosphate dehydrogenase (GAPDH); phosphoglycerate kinase (PGK); and triose phosphate isomerase (TPI).


21. The microbial cell according to any of claims 2 to 19, wherein the enzyme is selected from the group consisting of enolase and glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
22. The microbial cell according to claim 21, wherein the enzyme is enolase.
23. The microbial cell according to claim 21, wherein the enzyme is glyceraldehyde

3-phosphate dehydrogenase (GAPDH).


24. The microbial cell according to any of the preceding claims, wherein the microbial cell surface polypeptide is covalently or non-covalently bound to the surface of the microbial cell.
25. The microbial cell according to any of the preceding claims, wherein the microbial cell is natively producing the cell surface polypeptide.
26. The microbial cell according to any of claims 1 to 24, wherein the microbial cell is not natively producing the cell surface polypeptide.
27. The microbial cell according to any of claims 1 to 24, wherein the cell surface polypeptide is modified as compared to the intracellular equivalent.
28. The microbial cell according to claim 27, wherein the modification is a covalent or non-covalent modification.
29. The microbial cell according to claim 28, wherein the covalent modification is selected from the group consisting of deamidation, ribosylation, phosphorylation, methylation acetylation, alkylation, glycosylation, sulfation, amidation, and proteolytic processing.

30. The microbial cell according to any of the preceding claims, wherein the alteration is a change in the rpoB gene or in a polynucleotide capable of directing the expression of the rpoB gene.


31. A method for determining the probiotic potential of a candidate microbial cell, such as, but not limited to, a microbial cell according to any of claims 1-30, said cell comprising a microbial cell surface polypeptide and a substantially identical intracellular equivalent capable of converting a substrate in a metabolic pathway of the candidate microbial cell, said method comprising the steps of i) providing a candidate microbial cell for which the probiotic potential is to be determined, ii) performing a qualitative and/or quantitative determination of the production and/or secretion and/or post-translational modification in the candidate microbial cell of said microbial cell surface polypeptide, or determining another characteristic of said candidate microbial cell, wherein said other characteristic is related to or correlates with the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, iii) comparing the result of the determination performed in step ii) with a reference value indicative of the probiotic potential of a reference microbial cell, and iv) determining the probiotic potential of said candidate microbial cell based on the comparison performed in step iii).
32. The method of claim 31, wherein the reference value has been determined by performing step i) and ii) of claim 31 on a reference microbial cell, said reference microbial cell preferably having a probiotic potential.
33. The method of claim 31 or 32, wherein the reference microbial cell is a cell of the same species or subspecies, preferably of the same strain.
34. The method of claim any of claims 31 to 33, wherein the determination in step ii) is performed by comparing the relative production and/or secretion and/or post- translational modification of the microbial cell surface polypeptide to the

production and/or secretion and/or post-translational modification in L. plantarum

299v of said cell surface polypeptide under substantially identical growth conditions.
35. The method of any of claims 31 to 34, wherein the intracellular equivalent is selected from glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof.
36. A method for determining the probiotic potential of a starter culture, said starter culture comprising a plurality of microbial cells, such as, but not limited to, a plurality of microbial cells according to any of claims 1-30, said cells each comprising a microbial cell surface polypeptide and a substantially identical intracellular equivalent capable of converting a substrate in a metabolic pathway of the microbial cell, said method comprising the steps of i) providing a sample from a candidate starter culture for which the probiotic potential is to be determined, ii) performing on said sample a qualitative and/or quantitative determination of the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, or determining another characteristic on said sample, wherein said other characteristic is related to or correlates with the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, iii) comparing the result of the determination performed in step ii) with a reference value indicative of the probiotic potential of a reference starter culture, and iv) determining the probiotic potential of said candidate starter culture based on the comparison performed in step iii).
37. The method of claim 36, wherein the comparison in step iii) is performed by comparing the relative production and/or secretion and/or post-translational modification of the microbial cell surface polypeptide to the production in L.

plantarum 299v of said cell surface polypeptide under substantially identical growth conditions.


38. The method of claim 36 or 37, wherein the intracellular equivalent is selected from glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof.
39. A method for determining the probiotic potential of an end-user product, said end-user product comprising a plurality of microbial cells, such as, but not limited to, a plurality of microbial cells according to any of claims 1-30, said cells each comprising a microbial cell surface polypeptide and a substantially identical intracellular equivalent capable of converting a substrate in a metabolic pathway of the microbial cell, said method comprising the steps of i) providing a sample from a candidate end-user product for which the probiotic potential is to be determined, ii) performing on said sample a qualitative and/or quantitative determination of the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, or determining another characteristic on said sample, wherein said other characteristic is related to or correlates with the production and/or secretion and/or post-translational modification of said microbial cell surface polypeptide, iii) comparing the result of the determination performed in step ii) with a reference value indicative of the probiotic potential of a reference end- user product, and iv) determining the probiotic potential of said candidate end-user product based on the comparison performed in step iii).
40. The method of claim 39, wherein the comparison in step iii) is performed by comparing the relative production and/or secretion and/or post-translational modification of the microbial cell surface polypeptide to the production in L. plantarum 299v of said cell surface polypeptide under substantially identical growth conditions.

41. The method of claim 39 or 40, wherein the intracellular equivalent is selected from glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof.


42. A method for identifying a microbial cell with altered probiotic potential, comprising the steps of i) providing a plurality of cells of a Lactobacillus species or a plurality of cells of a Bifidobacterium species, ii) subjecting said plurality of cells to a selection and/or mutagenesis procedure, and iii) identifying a microbial cell with altered probiotic potential as compared to the cells provided in step i), by identifying a cell with an altered production and/or secretion and/or post-translational modification of cell surface polypeptide, said cell surface polypeptide having a substantially identical intracellular equivalent, wherein the activity of the intracellular equivalent is capable of converting a substrate in a metabolic pathway of the cell.
43. The method of claim 42, wherein said cell surface polypeptide is selected from the group consisting of glyceraidehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof.
44. The method of claim 43, wherein said cell surface polypeptide is glyceraldehyde phosphate dehydrogenase and said identification step comprises growing the cultures in a microtiter plate in an oxygen-depleted carbon dioxide-enriched atmosphere.
45. The method of any of claims 42 to 44, wherein the mutagenesis is performed in such way that on average fewer than 10000, such as fewer than 1000, e. g. fewer than 100, such as fewer than 10 mutations are introduced per cell.

46. The method of any of claims 42 to 45, wherein said steps are repeated once or several times, in each next round providing in step i) a plurality of cells derived from a cell identified in step iii) of the previous round.


47. The method of any of claims 42 to 46, further comprising the step of identifying the one or more genetic change (s) responsible for said altered probiotic potential.
48. The method of any of claims 42 to 47, further comprising the step of introducing the one or more genetic change (s) or a functionally equivalent genetic change into another microbial strain, preferably a into suitable production strain.
49. A microbial cell having an altered probiotic potential obtainable by any of the methods of claim 42 to 48.
50. A method for improving the probiotic potential of a microbial cell comprising a cell surface polypeptide having a substantially identical intracellular equivalent, wherein the activity of the intracellular equivalent is capable of converting a substrate in a metabolic pathway of the cell, said method comprising the steps of i) providing a microbial cell the probiotic potential of which is to be optimised, ii) cultivating the microbial cell in a growth medium under conditions allowing the microbial cell to undergo at least one cell division, wherein the probiotic potential of the microbial cell is improved by controlling, during the cultivation of the microbial cell, the presence or amount of one or more of the following components: a) reducing agents, such as glutathione and/or cysteine, preferably increasing the amount thereof, b) gasses, such oxygen or carbon dioxide, c) yeast extract, or components thereof, d) organic acids,

e) the carbon source, preferably carbohydrates, the nitrogen source, preferably proteins, peptides (like casaminoacids), amino acids, including any composition of naturally occurring amino acids, and precursors and/or derivatives thereof, as well as inorganic salts (like ammonium sulfate, acetamide, nitrates or nitrites), g) the oxygen content, h) the ionic strength of the growth medium, such as the NaCi content, i) the pH, j) low molecular weight compounds, preferably salts (sulfate, phosphate, ni- trate), and/or metals (e. g. , copper), and/or organic acids, k) cAMP level in the microbial cell, and I) a cell constituent, or a precursor thereof, preferably a co-factor, a vitamin, a lipid, and the like thereby controlling the production and/or secretion and/or post-translational modification of said cell surface polypeptide.


51. The method of claim 50, wherein the intracellular equivalent is selected from glyceraldehyde phosphate dehydrogenase, phosphoglycerate kinase, triose phosphate isomerase, and enolase, including variants and functional equivalents thereof.
52. A method for modulating an immune response and/or the amount and/or composition of mucosal mucins in an individual, said method comprising the steps of i) providing a microbial cell selected from a Lactobacillus cell and a

Bifidobacterium cell, such as, but not limited to, a microbial cell of any of claims 1 to 30, wherein said cell comprises at least one microbial cell surface polypeptide and a substantially identical intracellular equivalent thereof, wherein the activity of the intracellular equivalent is capable of converting a substrate in a metabolic pathway of the cell,


ii) contacting an epithelial cell or a cell of the mucosa-associated lymphoid tissue (MALT) of the individual with at least one microbial cell surface polypeptide, and iii) modulating an immune response and/or the amount and/or composition of mucosal mucins in an individual.


53. The method of claim 52, wherein the modulation of the immune response comprises a cytokine response.
54. The method of claim 53, wherein the cytokine response comprises a modulation of the synthesis and/or secretion of at least one cytokine selected from the group consisting of IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18 and IL-19, TNF-alpha, TNF-beta, LT-beta, CD40 ligand, Fas ligand, CD27 ligand, CD30 ligand, 4- BBL, TGF-beta, and interferons, including IFN-alpha, IFN-beta, and IFN-gamma.
55. The method of any of claims 53 to 54, wherein the modulation of the immune response further comprises an increased or decreased IgA production.
53. The method of any of claims 53 to 55, wherein the modulation of the immune response further comprises an increased or decreased IgE production.
54. The method of any of claims 53 to 53, wherein the modulation of the immune response further comprises a stimulation or repression of macrophage function.
55. The method of any of claims 53 to 54, wherein the modulation of the immune response further comprises a stimulation or repression of natural killer cell activity.
56. The method of any of claims 53 to 55, wherein the modulation of the immune response further comprises an activation or repression of the MALT system.

57. The method of any of claims 52 to 56, wherein the epithelial cell is selected from the group consisting of epithelial cells from an animal or human individual.


58. The method of any of claims 52 to 56, wherein the cell of the mucosa-associated lymphoid tissue (MALT) is selected from the group consisting of M-cells, antigen presenting cells (APCs), dendritic cells (DCs), T-lymphocytes, including Th1,

Th2, and CTL cells, IgA-committed B cells, macrophages, and natural killer (NK) cells.


59. The method of any of claims 52 to 58, wherein the substantially identical intracellular equivalent of the cell surface polypeptide is selected from the group consisting of Lactobacillus enzymes acting in a metabolic pathway and

Bifidobacterium enzymes acting in a metabolic pathway.


60. The method of claim 59, wherein the metabolic pathway is the glycolytic pathway or the pathway for uptake of carbohydrates (phosphotransferase uptake system).
61. The method of claim 59, wherein the enzyme is selected from the group consisting of hexokinase ; glucose 6-phosphate isomerase; phosphofructokinase; aidolase ; triose phosphate isomerase (TPI) ; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ; phosphoglycerate kinase (PGK); phosphoglycerate mutase ; enolase ; and pyruvate kinase.
62. The method of claim 61, wherein the enzyme is selected from the group consisting of enolase ; glyceraldehyde 3-phosphate dehydrogenase (GAPDH); phosphoglycerate kinase (PGK); and triose phosphate isomerase (TPI).
63. The method of claim 61, wherein the enzyme is selected from the group consisting of enolase and glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
64. The method of claim 61, wherein the enzyme is enolase.

65. The method of claim 61, wherein the enzyme is glyceraldehyde 3-phosphate dehydrogenase (GAPDH).


66. The method of any of claims 52 and 65, wherein the microbial cell surface polypeptide is covalently or non-covalently bound to the surface of a microbial cell.
67. The method of claim 66, wherein the microbial cell is a Lactobacillus cell.
68. The method of claim 66, wherein the microbial cell is a Bifidobacterium cell.
69. The method of claim 66, wherein the microbial cell is natively producing the cell surface polypeptide.
70. The method of claim 66, wherein the microbial cell is not natively producing the cell surface polypeptide.
71. The method of any of claims 52 to 70, wherein the cell surface polypeptide is modified as compared to the polypeptide when it is located intracellularly.
72. The method of claim 71, wherein the modification is a covalent modification.
73. The method of claim 72, wherein the covalent modification is selected from the group consisting of ribosylation, phosphorylation, methylation acetylation, alkylation, glycosylation, sulfation, amidation, proteolytic processing.
74. An isolated polynucleotide comprising a nucleic acid sequence which is at least

90% identical to at least one of SEQ ID NO : 1 ; SEQ ID NO : 3; SEQ ID NO : 5; and

SEQ ID NO : 7, wherein the percentage of identical nucleotides is determined by aligning the sequence and the compare sequences using the BLASTN algorithm version 2.04 set at default parameters described herein above, identifying the number of identical nucleotides over aligned portions of the sequence and the compare sequences, dividing the number of identical nucleotides by the total number of nucleic acids of the compare sequence, and multiplying by 100 to determine the percentage identical nucleotides.

75. The polynucleotide according to claim 74, wherein the polynucleotide comprises a nucleic acid sequence which is at least 94% identical to at least one of SEQ ID

NO : 1 ; SEQ ID NO : 3; SEQ ID NO : 5; and SEQID NO : 7.
76. The polynucleotide according to claim 74, wherein the polynucleotide comprises a nucleic acid sequence which is at least 96% identical to at least one of SEQ ID

NO : 1 ; SEQ ID NO : 3; SEQ ID NO : 5, and SEQ ID NO : 7.


77. The polynucleotide according to claim 74, wherein the polynucleotide comprises a nucleic acid sequence which is at least 98% identical to at least one of SEQ ID

NO : 1 ; SEQ ID NO : 3; SEQ ID NO : 5; and SEQ ID NO : 7.


78. The polynucleotide according to any of claims 74 to 77, wherein the polynucleotide comprises: i) a nucleic acid sequence selected from the group consisting of SEQ ID

NO : 1 ; SEQ) D N0 : 3; SEQ ID NO : 5; and SEQ ID NO : 7, or ii) a nucleic acid sequence selected from the group consisting of the coding sequence part of SEQ iD N0 : 1 ; SEQ ID NO : 3; SEQ ID NO : 5; and SEQ

ID N0 : 7, or iii) a nucleic acid sequence selected from the group consisting of (a) the coding sequence of gap encoding a glyceraldehyde 3-phosphate dehydrogenase (Gap) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843) ; (b) the coding sequence of pgk encoding a phosphoglycerate kinase (Pgk) of L. plantarum 299v deposited with

DSMZ under accession number DSM 9843) (c) the coding sequence of tpi encoding a triosephosphate isomerase (Tpi) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843), and (d) the coding sequence of eno encoding an enolase (Eno) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843), or


iv) a nucleic acid sequence encoding a polypeptide selected from the group consisting of SEQ ID NO : 2; SEQ ID NO : 4; SEQ ID NO : 6; and SEQ ID

NO : 8, or v) a nucleic acid sequence hybridising under stringent hybridisation conditions to a nucleic acid sequence listed in any of i), ii) iii), and iv), or vi) a nucleic acid sequence selected from the group consisting of (a) a complement of a nucleic acid sequence listed in any of i), ii), iii), and iv); (b) a reverse complement of a nucleic acid sequence listed in i), ii), iii), and iv); and (c) a reverse sequence of a nucleic acid sequence listed in i), ii), iii), and iv), or vii) a nucleic acid sequence selected from the group consisting of: (a) a sequence comprising more than 200 consecutive nucleotides of a nucleic acid sequence listed in any of i), ii), iii), and iv); (b) a sequence comprising more than 100 consecutive nucleotides of a nucleic acid sequence listed in any of i), ii), iii), and iv); (c) a sequence comprising more than 50 consecutive nucleotides of a nucleic acid sequence listed in any of i), ii), iii), and iv); and (d) a sequence comprising more than 25 consecutive nucleotides of a nucleic acid sequence listed in any of i), ii), iii), and iv).
79. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO : 1 ;

SEQ ID NO : 3; SEQ ID NO : 5; and SEQ ID NO : 7.


80. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence selected from the group consisting of the coding sequence part of SEQ ID NO : 1 ; SEQ ID NO : 3; SEQ ID NO : 5; and SEQ ID NO : 7.
81. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence selected from the group consisting of (a) the coding sequence of gap encoding a glyceraldehyde 3-phosphate dehydrogenase (Gap) of L. plantarum 299v deposited with DSMZ under accession number DSM
9843); (b) the coding sequence of pgk encoding a phosphoglycerate kinase (Pgk) of L. plantarum 299v deposited with DSMZ under accession number DSM

9843) (c) the coding sequence of tpi encoding a triosephosphate isomerase (Tpi) of L. plantarum 299v deposited with DSMZ under accession number DSM

9843), and (d) the coding sequence of eno encoding an enolase (Eno) of L. plantarum 299v deposited with DSMZ under accession number DSM 9843).
82. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence encoding a polypeptide selected from the group consisting of SEQ ID NO : 2; SEQ ID NO : 4; SEQ ID NO : 6; and SEQ ID NO : 8.
83. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence hybridising under stringent hybridisation conditions to a nucleic acid sequence selected from the group consisting of SEQ ID NO : 1 ; SEQ

ID NO : 3; SEQ ID NO : 5 and SEQ ID NO : 7.


84. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence selected from the group consisting of (a) a complement of a nucleic acid sequence selected from the group consisting of SEQ ID NO : 1 ;

SEQ ID NO : 3; SEQ ID NO : 5 and SEQ ID N0 : 7; (b) a reverse complement of a nucleic acid sequence selected from the group consisting of SEQ ID NO : 1 ; SEQ ID NO : 3 ; SEQ ID NO : 5 and SEQ ! D N0 : 7 ; and (c) a reverse sequence of a nucleic acid sequence selected from the group consisting of SEQ ID NO : 1 ; SEQ

ID NO : 3; SEQ ID NO : 5 and SEQ ID N0 : 7.
85. The polynucleotide according to claim 78, wherein the polynucleotide comprises a nucleic acid sequence selected from the group consisting of: (a) a sequence comprising more than 200 consecutive nucleotides of a nucleic acid sequence selected from the group consisting of SEQ ID NO : 1 ; SEQ ID NO : 3; SEQ ID

NO : 5 and SEQ ID N0 : 7; (b) a sequence comprising more than 100 consecutive nucleotides of a nucleic acid sequence selected from the group consisting of SEQID NO : 1 ; SEQID NO : 3; SEQID NO : 5 and SEQID NO : 7; (c) a sequence comprising more than 50 consecutive nucleotides of a nucleic acid sequence selected from the group consisting of SEQID NO : 1 ; SEQID NO : 3; SEQ ID

NO : 5 and SEQ ID NO : 7; and (d) a sequence comprising more than 25

consecutive nucleotides of a nucleic acid sequence selected from the group consisting of SEQ ID NO : 1 ; SEQ ID NO : 3; SEQ ID NO : 5 and SEQ ID NO : 7.


86. The polynucleotide according to any of claims 74 to 78, wherein the polynucleotide is selected from the group consisting of i) a polynucleotide comprising nucleotides 1285 to 2307 of SEQ ID NO : 11, and ii) a polynucleotide comprising or essentially consisting of the coding se- quence of gap encoding a glyceraldehyde 3-phosphate dehydrogenase of Lactobacillus plantarum 299v, as deposited with DSMZ under acces- sion number DSM 9843 ; and iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO : 2 ; and iv) a polynucleotide encoding a fragment of a polypeptide encoded by poly- nucleotides (i), (ii) or (iii), wherein said fragment a) has glyceraldehyde 3-phosphate dehydrogenase activity ; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 2 ; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 2 for binding to at least one predetermined binding partner; and v) a polynucleotide, the complementary strand of which hybridises, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that a) has glyceraldehyde 3-phosphate dehydrogenase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 2; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 2 for binding to at least one predetermined binding partner, vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v), and the complementary strand of such a polynucleotide.


87. The polynucleotide according to claim 86, wherein the polynucleotide comprises nucleotides 1285 to 2307 of SEQ ID NO : 11.
88. The polynucleotide according to claim 86, wherein the polynucleotide comprises or essentially consists of the coding sequence of gap encoding a glyceraldehyde

3-phosphate dehydrogenase of Lactobacillus plantarum 299v, as deposited with

DSMZ under accession number DSM 9843.
89. The polynucleotide according to claim 86, wherein the polynucleotide encodes a polypeptide having the amino acid sequence as shown in SEQ ID NO : 2.
90. The polynucleotide according to claim 86, wherein the polynucleotide encodes a fragment of the polypeptide having the amino acid sequence as shown in SEQ

ID NO : 2, wherein said fragment a) has glyceraldehyde 3-phosphate dehydrogenase activity ; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 2; and/or


c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 2 for binding to at least one predetermined binding partner.


91. The polynucleotide according to claim 86, wherein the complementary strand of said polynucleotide hybridises under stringent conditions with a polynucleotide that a) has glyceraldehyde 3-phosphate dehydrogenase activity; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 2; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 2 for binding to at least one predetermined binding partner.
92. The polynucleotide according to any of claims 90 and 91, wherein the polynu- cleotide is degenerated.
93. The polynucleotide according to any of claims 74 to 78, wherein the polynucleotide is selected from the group consisting of i) a polynucleotide comprising nucleotides 2428 to 2630 of SEQ ID NO : 11, and ii) a polynucleotide comprising or essentially consisting of the coding se- quence of pgk encoding a phosphoglycerate kinase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843 ; and iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO : 4; and

iv) a polynucleotide encoding a fragment of a polypeptide encoded by poly- nucleotides (i), (ii) or (iii), wherein said fragment a) has phosphoglycerate kinase activity; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 4; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 4 for binding to at least one predetermined binding partner; and v) a polynucleotide, the complementary strand of which hybridises, under strin- gent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that a) has phosphoglycerate kinase activity ; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 4 ; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 4 for binding to at least one predetermined binding partner, vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v), and the complementary strand of such a polynucleotide.


94. The polynucleotide according to claim 93, wherein the polynucleotide comprises nucleotides 2428 to 3630 of SEQ ID NO : 11.
95. The polynucleotide according to claim 93, wherein the polynucleotide comprises or essentially consists of the coding sequence of pgk encoding a phosphoglyc-

erate kinase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843.


96. The polynucleotide according to claim 93, wherein the polynucleotide encodes a polypeptide having the amino acid sequence as shown in SEQ ID NO : 4.
97. The polynucleotide according to claim 93, wherein the polynucleotide encodes a fragment of the polypeptide having the amino acid sequence as shown in SEQ ID NO : 4, wherein said fragment a) has phosphoglycerate kinase activity; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 4; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 4 for binding to at least one predetermined binding partner.
98. The polynucleotide according to claim 93, wherein the complementary strand of said polynucleotide hybridises under stringent conditions with a polynucleotide that a) has phosphoglycerate kinase activity; and/or b) is recognised by an antibody, or a binding fragment thereof, which is ca- pable of recognising SEQ ID NO : 4; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 4 for binding to at least one predetermined binding partner.
99. The polynucleotide according to any of claims 97 and 98, wherein the polynu- cleotide is degenerated.

100. The polynucleotide according to any of claims 74 to 78, wherein the polynucleotide is selected from the group consisting of i) a polynucleotide comprising nucleotides 3657 to 4415 of SEQ ID NO : 11, and ii) a polynucleotide comprising or essentially consisting of the coding se- quence of tpi encoding a triose phosphate isomerase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM

9843; and iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO : 6; and iv) a polynucleotide encoding a fragment of a polypeptide encoded by poly- nucleotides (i), (ii) or (iii), wherein said fragment a) has triose phosphate isomerase activity; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 6; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 6 for binding to at least one predetermined binding partner; and v) a polynucleotide, the complementary strand of which hybridises, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that a) has triose phosphate isomerase activity; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 6; and/or

c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 6 for binding to at least one predetermined binding partner, vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v), and the complementary strand of such a polynucleotide.


101. The polynucleotide according to claim 100, wherein the polynucleotide comprises nucleotides 3657 to 4415 of SEQ ID NO : 11.
102. The polynucleotide according to claim 100, wherein the polynucleotide comprises or essentially consists of the coding sequence of tpi encoding a triose phosphate isomerase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843.
103. The polynucleotide according to claim 100, wherein the polynucleotide encodes a polypeptide having the amino acid sequence as shown in SEQ ID

NO : 6.
104. The polynucleotide according to claim 100, wherein the polynucleotide encodes a fragment of the polypeptide having the amino acid sequence as shown in SEQ ID NO : 6, wherein said fragment a) has triosephosphate isomerase activity ; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 6; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 6 for binding to at least one predetermined binding partner.

105. The polynucleotide according to claim 100, wherein the complemen- tary strand of said polynucleotide hybridises under stringent conditions with a polynucleotide that a) has triose phosphate isomerase activity; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 6; and/or c) is competing with a polypeptide comprising or essentially consist- ing of the amino acid sequence as shown in SEQ ID NO : 6 for binding to at least one predetermined binding partner.
106. The polynucleotide according to any of claims 104 and 105, wherein the polynucleotide is degenerated.
107. The polynucleotide according to any of claims 74 to 78, wherein the polynucleotide is selected from the group consisting of i) a polynucleotide comprising nucleotides 4497 to 5825 of SEQ ID NO : 11, and ii) a polynucleotide comprising or essentially consisting of the coding se- quence of eno encoding an enolase of Lactobacillus plantarum 299v, as deposited with DSMZ under accession number DSM 9843 ; and iii) a polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO : 8 ; and iv) a polynucleotide encoding a fragment of a polypeptide encoded by poly- nucleotides (i), (ii) or (iii), wherein said fragment a) has enolase activity; and/or

b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 8; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 8 for binding to at least one predetermined binding partner; and v) a polynucleotide, the complementary strand of which hybridises, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) (iii), and (iv), and encodes a polypeptide that a) has enolase activity; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 8; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 8 for binding to at least one predetermined binding partner, vi) a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iv) and (v), and the complementary strand of such a polynucleotide.


108. The polynucleotide according to claim 107, wherein the polynucleotide comprises nucleotides 4497 to 5825 of SEQ ID NO : 11.
109. The polynucleotide according to claim 107, wherein the polynucleotide comprises or essentially consists of the coding sequence of eno encoding an enolase of Lactobacillus plantarum 299v, as deposited with DSMZ under acces- sion number DSM 9843.

110. The polynucleotide according to claim 107, wherein the polynucleotide encodes a polypeptide having the amino acid sequence as shown in SEQ ID

NO : 8.
111. The polynucleotide according to claim 107, wherein the polynucleotide encodes a fragment of the polypeptide having the amino acid sequence as shown in SEQ ID NO : 8, wherein said fragment a) has enolase activity; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising SEQ ID NO : 8; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 8 for binding to at least one predetermined binding partner.
112. The polynucleotide according to claim 107, wherein the complemen- tary strand of said polynucleotide hybridises under stringent conditions with a polynucleotide that a) has enolase activity ; and/or b) is recognised by an antibody, or a binding fragment thereof, which is ca- pable of recognising SEQ ID NO : 8 ; and/or c) is competing with a polypeptide comprising or essentially consisting of the amino acid sequence as shown in SEQ ID NO : 8 for binding to at least one predetermined binding partner.
113. The polynucleotide according to any of claims 111 and 112, wherein the polynucleotide is degenerated.
114. A vector comprising the polynucleotide according to any of claims 74 to 113.

115. A host cell comprising the polynucleotide according to any of claims 74 to 113, or the vector according to claim 114.


116. The host cell according to claim 115 selected from the group consist- ing of Gram-positive, non-pathogenic bacteria.
117. The host cell according to claim 116 selected from the group consist- ing of the genus of Lactobacillus.
118. The microbial cell of any of claims 1 to 30 or the host cell according to claim 117 selected from Lactobacillus acetotolerans, Lactobacillus acidipiscis,

Lactobacillus acidophilus, Lactobacillus agilis, Lactobacillus algidus, Lactobacil- lus alimentarius, Lactobacillus amylolyticus, Lactobacillus amylophilus, Lactoba- cillus amylovorus, Lactobacillus animais, Lactobacillus arizonensis, Lactobacil- lus aviarius, Lactobacillus bifermentans, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus coelohominis, Lactobacillus collinoi- des, Lactobacillus coryniformis subsp. coryniformis, Lactobacillus coryniformis subsp. torques, Lactobacillus crispatus, Lactobacillus curvatus, Lactobacillus cypricasei, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus delbrueckii subsp delbrueckii, Lactobacillus delbrueckii subsp. lactis, Lactobacillus durianus,

Lactobacillus equi, Lactobacillus farciminis, Lactobacillus ferintoshensis, Lacto- bacillus fermentum, Lactobacillus fornicalis, Lactobacillus fructivorans, Lactoba- cillus frumenti, Lactobacillus fuchuensis, Lactobacillus gallinarum, Lactobacillus gasseri, Lactobacillus graminis, Lactobacillus hamsteri, Lactobacillus helveticus,

Lactobacillus helveticus subsp. jugurti, Lactobacillus heterohiochii, Lactobacillus hilgardii, Lactobacillus homohiochii, Lactobacillus intestinalis, Lactobacillus japonicus, Lactobacillus jensenii, Lactobacillus johnsonii, Lactobacillus kefiri,

Lactobacillus kimchii, Lactobacillus kunkeei, Lactobacillus leichmannii, Lactoba- cillus letivazi, Lactobacillus lindneri, Lactobacillus malefermentans, Lactobacillus mali, Lactobacillus maltaromicus, Lactobacillus manihotivorans, Lactobacillus mindensis, Lactobacillus mucosae, Lactobacillus murinus, Lactobacillus nagelii,

Lactobacillus oris, Lactobacillus panis, Lactobacillus pantheri, Lactobacillus parabuchneri, Lactobacillus paracasei subsp. paracasei, Lactobacillus paracasei subsp. pseudoplantarum"Lactobacillus paracasei subsp. tolerans, Lactobacillus


parakefiri, Lactobacillus paralimentarius, Lactobacillus paraplantarum, Lactoba- cillus pentosus, Lactobacillus perolens, Lactobacillus plantarum, Lactobacillus pontis, Lactobacillus psittaci, Lactobacillus reuteri, Lactobacillus rhamnosus,

Lactobacillus ruminis, Lactobacillus sakei, Lactobacillus salivarius, Lactobacillus salivarius subsp. salicinius, Lactobacillus salivarius subsp. salivarius, Lactoba- cillus sanfranciscensis, Lactobacillus sharpeae, Lactobacillus suebicus, Lacto- bacillus thermophilus, Lactobacillus thermotolerans, Lactobacillus vaccinoster- cus, Lactobacillus vaginalis, Lactobacillus versmoldensis, Lactobacillus vitulinus,

Lactobacillus vermiforme, Lactobacillus zeae 119. The host cell according to claim 118, wherein said host cell is Lactoba- cillus plantarum.


120. The host cell according to claim 116 selected from the group consist- ing of the genus of Bifidobacterium.
121. The microbial cell of any of claims 1 to 30 or the host cell according to claim 120 selected from the group consisting of Bifidobacterium adolescentis,

Bifidobacterium aerophilum, Bifidobacterium angulatum, Bifidobacterium ani- malis, Bifidobacterium asteroides, Bifidobacterium bifidum, Bifidobacterium boum, Bifidobacterium breve, Bifidobacterium catenulatum, Bifidobacterium choerinum, Bifidobacterium coryneforme, Bifidobacterium cunicuii, Bifidobacte- rium dentium, Bifidobacterium gallium, Bifidobacterium gallinarum,, Bifidobac- terium indicum, Bifidobacterium longum, Bifidobacterium longum bv Longum, Bi- fidobacterium longum bv. Infantis, Bifidobacterium longum bv. Suis, Bifidobacte- rium magnum, Bifidobacterium merycicum, Bifidobacterium minimum, Bifido- bacterium pseudocatenulatum, Bifidobacterium pseudolongum, Bifidobacterium pseudolongum subsp. globosum, Bifidobacterium pseudolongum subsp. pseu- dolongum, Bifidobacterium psychroaerophilum, Bifidobacterium pullorum, Bifi- dobacterium ruminantium, Bifidobacterium saeculare, Bifidobacterium scardovii,

Bifidobacterium subtile, Bifidobacterium thermoacidophilum, Bifidobacterium thermoacidophilum subsp. suis, Bifidobacterium thermophilum, Bifidobacterium urinais.

122. The host cell according to claim 115, wherein said host cell is Lactoba- cillus plantarum.


123. The host cell according to claim 115, wherein said host cell is Lactoba- cillus plantarum 299v or a variant thereof.
124. The host cell according to claim 115, wherein said host cell is Lactoba- cillus rhamnosus.
125. The host cell according to claim 115, wherein said host cell is Lactoba- cillus rhamnosus 271 (DSM 6594) or a variant thereof.
126. The host cell according to claim 115, wherein said host cell is Lactoba- cillus paracasei.
127. The host cell according to claim 115, wherein said host cell is Lactoba- cillus paracasei 8700 : 2 (DSM 13434) or a variant thereof.
128. The host cell according to claim 115, wherein said host cell is Lactoba- cillus paracasei 02A (DSM 13432) or a variant thereof.
129. A method for producing a microbial cell surface polypeptide capable of modulating an immune response, or a fragment thereof, comprising the step of culturing the microbial cell of any of claims 1 to 30 or the host cell according to any of claims 115 to 128 under conditions suitable for the production of said im- munomodulating polypeptide, or fragment thereof.
130. A method for producing a microbial cell surface polypeptide capable of modulating the amount and/or composition of mucosal mucins, or a fragment thereof, comprising the step of culturing the microbial cell of any of claims 1 to

30 or the host cell according to any of claims 115 to 128 under conditions suit- able for the production of said immunomodulating polypeptide, or fragment thereof.

131. A method for producing an epithelial adhesive polypeptide, or a frag- ment thereof, comprising the step of culturing the microbial cell of any of claims

1 to 30 or the host cell according to any of claims 115 to 128 under conditions suitable for the production of said epithelial adhesive polypeptide, or fragment thereof.


132. A polypeptide comprising an amino acid sequence which is at least

90% identical to at least one of SEQ ID NO : 2; SEQ ID NO: 4; SEQ ID NO : 6; and

SEQ ID NO : 8, including variants and functional equivalents thereof.
133. The polypeptide according to claim 132 comprising SEQ ID NO : 2.
134. The polypeptide according to claim 132 comprising SEQ ID NO : 4.
135. The polypeptide according to claim 132 comprising SEQ ID NO : 6.
136. The polypeptide according to claim 132 comprising SEQ ID NO : 8.
137. An antibody against the polypeptide of any of claims 132 to 136.
138. The antibody according to claim 137 selected from monoclonal anti- bodies and polyclonal antibodies.
139. An antagonist capable of inhibiting the activity or expression of the polypeptide according to any of claims 132 to 136.
140. An agonist capable of enhancing the activity or expression of the poly- peptide according to any of claims 132 to 136.
141. A complex comprising the polypeptide according to any of claims 132 to 136 and the antagonist of claim 139 or the agonist of claim 140.
142. A method for the treatment of an individual comprising the step of administering to the individual a therapeutically effective amount of the polype- tide of any of claims 132 to 136.

143. A method for the treatment of an individual comprising the step of administering to the individual a therapeutically effective amount of the microbial cell of any of claims 1 to 30 or the host cell of any of claims 115 to 128.


144. A method for the treatment of an individual comprising the steps of administering to the individual a therapeutical effective amount of the antago- nist of claim 139 or the agonist of claim 140.
145. A method for identifying compounds which interact with and inhibit or activate an activity of the polypeptide of any of claims 132 to 136 comprising the steps of i) contacting a composition comprising the polypeptide with the compound to be screened under conditions to permit interaction between the com- pound and the polypeptide to assess the interaction of a compound, such interaction being associated with a second component capable of pro- viding a detectable signal in response to the interaction of the polype- tide with the compound ; and ii) determining whether the compound interacts with and activates or inhib- its an activity of the polypeptide by detecting the presence or absence of a signal generated from the interaction of the compound with the poly- peptide.
146. A method for treating an auto-immune disease in an individual comprising the step of administering to the individual a pharmaceutical effective amount of the polypeptide according to any of claims 132 to 136, or the microbial cell of any of claims 1 to 30 or the host cell according to any of claims to 115 to 128.
147. A polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136 or the microbial cell of any of claims 1 to 30 or the host cell according to any of claims 115 to 128, for use as a medicament.

148. Use of a polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136 or the microbial cell of any of claims 1 to 30 or the host cell according to any of claims 115 to 128, for the manufacture of a medicament for treatment of a disease, wherein said treatment benefits from modulation of the immune response.


149. Use according to claim 148 for treatment of inflammatory bowel dis- ease, rheumatoid arthritis, multiple sclerosis, arteriosclerosis, allergy and dia- betes (type 1), multiple sclerosis, Hashimotos thyroiditis, pernicious anemia,

Addison's disease, myasthenia gravis, rheumatoid arthritis, uveitis, psoriasis,

Guillain-Barre Syndrome, Grave's disease, Systemic autoimmune diseases in- cluding systemic lupus erythematosus and dermatomyositis, asthma, eczema, topical dermatitis, contact dermatitis, other eczematous dermatitides, sebor- rheic dermatitis, rhinitis, Lichen planus, Pemplugus, bullous Pemphigoid, Epi- dermolysis bullosa, uritcaris, angioedemas, vasculitides, erythemas, cutaneous eosinophilias, Alopecia areata, atherosclerosis, primary biliary cirrhosis and ne- phrotic syndrome. Related diseases include intestinal inflammations, such as

Coeliac disease, proctitis, eosinophilia gastroenteritis, mastocytosis, inflamma- tory bowel disease, Crohn's disease and ulcerative colitis, as well as food- related allergies.


150. A pharmaceutical composition comprising a therapeutical effective amount of at least one polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136 or the microbial cell of any of claims 1 to 30 or the host cell according to claims 115 to 128, and at least one excipient.
151. A nutritional supplement comprising at least the microbial cell of any of claims 1 to 30, or at least the host cell according to any one of claims 115 to 128 and/or at least a polypeptide and variants and functional equivalents thereof ac- cording to any one of claims 132 to 136.
152. Use of a polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136 and/or at least the microbial cell of

any of claims 1 to 30 or at least a host cell according to any one of claims 115 to

128 for the manufacture of a nutritional supplement for treatment of a disease which benefit from modulation of the immune response.
153. Use according to claim 152 for treatment of inflammatory bowel dis- ease, rheumatoid arthritis, multiple sclerosis, arteriosclerosis, allergy and dia- betes (type 1), multiple sclerosis, Hashimotos thyroiditis, pernicious anemia,

Addison's disease, myasthenia gravis, rheumatoid arthritis, uveitis, psoriasis,

Guillain-Barre Syndrome, Grave's disease, Systemic autoimmune diseases in- cluding systemic lupus erythematosus and dermatomyositis, asthma, eczema, topical dermatitis, contact dermatitis, other eczematous dermatitides, sebor- rheic dermatitis, rhinitis, Lichen planus, Pemplugus, bullous Pemphigoid, Epi- dermolysis bullosa, uritcaris, angioedemas, vasculitides, erythemas, cutaneous eosinophilias, Alopecia areata, atherosclerosis, primary biliary cirrhosis and ne- phrotic syndrome. Related diseases include intestinal inflammations, such as

Coeliac disease, proctitis, eosinophilia gastroenteritis, mastocytosis, inflamma- tory bowel disease, Crohn's disease and ulcerative colitis, as well as food- related allergies.


154. A food, preferably a dairy food, comprising at least the microbial cell of any of claims 1 to 30 or the host cell according to any one of claims 115 to 128, and/or at least a polypeptide and variants and functional equivalents thereof ac- cording to any one of claims 132 to 136.
155. Use of a polypeptide and variants and functional equivalents thereof according to any one of claims 132 to 136 and/or a microbial cell according to any of claims 1 to 30 and/or at least a host cell according to any one of claims

115 to 128 for the manufacture of a food for treatment of a disease which benefit from modulation of the immune response.


156. Use according to claim 155 for treatment of inflammatory bowel disease, rheumatoid arthritis, multiple sclerosis, arteriosclerosis, allergy and diabetes (type 1), multiple sclerosis, Hashimotos thyroiditis, pernicious anemia, Addison's disease, myasthenia gravis, rheumatoid arthritis, uveitis, psoriasis, Guillain-Barre Syndrome, Grave's disease, Systemic autoimmune diseases including systemic lupus erythe-

matosus and dermatomyositis, asthma, eczema, topical dermatitis, contact dermatitis, other eczematous dermatitides, seborrheic dermatitis, rhinitis, Lichen planus, Pemplugus, bullous Pemphigoid, Epidermolysis bullosa, uritcaris, angioedemas, vasculitides, erythemas, cutaneous eosinophilias, Alopecia areata, atherosclerosis, primary biliary cirrhosis and nephrotic syndrome. Related diseases include intestinal inflammations, such as Coeliac disease, proctitis, eosinophilia gastroenteritis, mas- tocytosis, inflammatory bowel disease, Crohn's disease and ulcerative colitis, as well as food-related allergies.



1   ...   58   59   60   61   62   63   64   65   ...   71


The database is protected by copyright ©dentisty.org 2016
send message

    Main page