Pcr rules and Primer design



Download 40.5 Kb.
Date19.07.2018
Size40.5 Kb.
PCR rules and Primer design

PCR generally consists of cycling between different temperature that separate double stranded DNA into single strands (denaturing temperature), allow the primers to find their complementary sequences (annealing temperature) and allow the polymerase to add nucleotides in order to make the new double strand of DNA (elongation temperature). The cycling of these temperatures results in the doubling of the amount of DNA with each cycle such that after 30 cycles a lot of DNA is present in the tube. How much DNA would you have after 30 cycles if you started with one DNA strand?


Denaturing Temperature and Time

The specific complementary association due to hydrogen bonding of single-stranded nucleic acids is referred to as "annealing": two complementary sequences will form hydrogen bonds between their complementary bases (G to C, and A to T)and form a stable double-stranded, anti-parallel "hybrid" molecule. One may make nucleic acid single-stranded by heating it to a point above the "melting temperature" of the double-stranded form. If it is heated in buffers of ionic strength lower than 150mM NaCl, the melting temperature is generally less than 100°C - which is why PCR works with denaturing temperatures of 91-97°C. Taq polymerase has an apparent half-life of 30 min at 95°C, which is partly why one should not do more than about 30 amplification cycles. Normally the denaturation time is 1 min at 94°C: it is possible, for short template sequences, such as plasmids, to reduce this to 30 sec.


Annealing Temperature and Primer Design

Primer length and sequence are of critical importance in designing the parameters of a successful amplification: the melting temperature of a double stranded DNA increases both with its length, and with increasing (G+C) content. Why does more GC content increase the melting temperature?—Consider how GC hydrogen bonding is different from AT hydrogen bonding. A simple formula for calculation of the Tm is

Tm = 4(G + C) + 2(A + T)°C.
Thus, the annealing temperature chosen for a PCR depends directly on length and nucleotide composition of the primer(s). As a general rule, the annealing temperature (Ta) of about 5°C below the lowest Tm of the primers is a good place to start testing of the primers.
Annealing does not take long: most primers will anneal efficiently in 30 sec or less, unless the Ta is too close to the Tm, or unless they are unusually long.
Elongation Temperature and Time

This is normally 70 - 72°C, for 0.5 - 3 min. A general rule for primer extension is 1 min is sufficient for reliable amplification of 1kb. Longer products require longer times: 3 min is a good for 3kb and longer products. Longer times are also be helpful in later cycles when product concentration exceeds enzyme concentration and when dNTP and / or primer depletion becomes limiting.


Primer Length

A prime consideration is that the primers should be complex enough so that the likelihood of annealing to sequences other than the chosen target is very low.


For example, there is a 1/4 chance (4-1) of finding an A, G, C or T in any given DNA sequence; there is a 1/16 chance (4-2) of finding any dinucleotide sequence (e.g. AG); a 1/256 chance of finding a given 4-base sequence. Thus, a sixteen base sequence will statistically be present only once in every 416 bases (=4 294 967 296, or 4 billion): this is about the size of the human or maize genome, and 1000x greater than the genome size of E. coli. Consequently, 17-mer or longer primers are routinely used for amplification from genomic DNA of animals and plants. In general, oligonucleotides between 18 and 24 bases are extremely sequence specific
G/C content and Polypyrimidine (T, C) or polypurine (A, G) stretches

The base composition of primers should be between 45% and 55% GC. The primer sequence must be chosen such that long stretches of Gs and Cs are avoided, GC rich regions can promote non-specific annealing. Long AT stretches are also to be avoided as these will “breath” and open up stretches of the primer-template complex. Why would AT promote breathing? Ideally the primer will have a near random mix of nucleotides, a 50% GC content and be ~20 bases long. This will also put the Tm in the range of 56°C – 62°C.


3’-end Sequence

The inclusion of one or two G and/or C residues at the 3' end of primers can provide stability to the primer annealing to the template. This “GC Clamp” helps to ensure correct binding at the 3' end due to the stronger hydrogen bonding of G/C residues. It also helps to improve the efficiency of the reaction by minimizing any “breathing” that might occur. More than two CG residues at the 3' end should be avoided, mis-priming can occur due to the stability of the GC hydrogen bonding.


Melting Temperature (Tm)

It is important to keep in mind that there are two primers added to a PCR reaction. Both of the oligonucleotide primers should be designed such that they have similar melting temperatures. If primers are mismatched in terms of Tm, amplification will be less efficient or may not work at all since the primer with the higher Tm will mis-prime at lower temperatures and the primer with the lower Tm may not work at higher temperatures.


Examples of inter- and intra-primer binding which would result in problems:

Another complication with primers can occur when primers bind to themselves (i.e. hairpin loop) or when two primers bind to each other (primer dimers). Primer dimers can occur between two of the same primers or two different primers. The best way to avoid these problems is to avoid complementary base pairing, within and between primers.


Two primers binding (primer dimer):

5'-ACGTCCAAGAGGAAGCG-3'

||||

3'-ACTTACGACTTTCGAATGTAA-5'


One primer binding (hairpin loop)

5'- ATGTCCAAGAGGAAGCGCCTCTT -3'

****** ******

G

A C



A G

G*C


G*C

A*T


G*C

A*T


A*T

5'-ACGTCC


A simple set of rules for primer sequence design:
1. primers should be 18-24 bases in length;

2. base composition should be 45-55% (G+C);

3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming;

4. Tms between 55-70°C are preferred (Tas, annealing temperatures, are approximately 5°C lower than the Tm);

5.The Tm for your primer pair should be within 2 degrees of each other, though ideally the same.

6. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided;

7. 3'-ends of primers should not be complementary (i.e. base pair), as otherwise the formation of primer dimers will result;

8. primer self-complementary (ability to form secondary structures such as hairpins) should be avoided.

In the below plasmid sequence a gene is highlighted in yellow. If you are asked to design primers to amplify this region, or most of this region, of DNA, you will need to follow the above primer design rules and design a forward and reverse primer. Below are 9 possible primer pairs, determine which primer pair is the best choice and explain why the other primers are not good choices. You will need to calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.


1 atcgatgcat aatgtgcctg tcaaatggac gaagcaggga ttctgcaaac cctatgctac

61 tccgtcaagc cgtcaattgt ctgattcgtt accaattatg acaacttgac ggctacatca

121 ttcacttttt cttcacaacc ggcacggaac tcgctcgggc tggccccggt gcatttttta

181 aatacccgcg agaaatagag ttgatcgtca aaaccaacat tgcgaccgac ggtggcgata

241 ggcatccggg tggtgctcaa aagcagcttc gcctggctga tacgttggtc ctcgcgccag

301 cttaagacgc taatccctaa ctgctggcgg aaaagatgtg acagacgcga cggcgacaag

361 caaacatgct gtgcgacgct ggcgatatca aaattgctgt ctgccaggtg atcgctgatg

421 tactgacaag cctcgcgtac ccgattatcc atcggtggat ggagcgactc gttaatcgct

481 tccatgcgcc gcagtaacaa ttgctcaagc agatttatcg ccagcagctc cgaatagcgc

541 ccttcccctt gcccggcgtt aatgatttgc ccaaacaggt cgctgaaatg cggctggtgc

601 gcttcatccg ggcgaaagaa ccccgtattg gcaaatattg acggccagtt aagccattca

661 tgccagtagg cgcgcggacg aaagtaaacc cactggtgat accattcgcg agcctccgga

721 tgacgaccgt agtgatgaat ctctcctggc gggaacagca aaatatcacc cggtcggcaa

781 acaaattctc gtccctgatt tttcaccacc ccctgaccgc gaatggtgag attgagaata

841 taacctttca ttcccagcgg tcggtcgata aaaaaatcga gataaccgtt ggcctcaatc

901 ggcgttaaac ccgccaccag atgggcatta aacgagtatc ccggcagcag gggatcattt

961 tgcgcttcag ccatactttt catactcccg ccattcagag aagaaaccaa ttgtccatat

1021 tgcatcagac attgccgtca ctgcgtcttt tactggctct tctcgctaac caaaccggta

1081 accccgctta ttaaaagcat tctgtaacaa agcgggacca aagccatgac aaaaacgcgt

1141 aacaaaagtg tctataatca cggcagaaaa gtccacattg attatttgca cggcgtcaca

1201 ctttgctatg ccatagcatt tttatccata agattagcgg atcctacctg acgcttttta

1261 tcgcaactct ctactgtttc tccatacccg tttttttggg ctagaaataa ttttgtttaa

1321 ctttaagaag gagatataca tatggctagc aaaggagaag aacttttcac tggagttgtc

1381 ccaattcttg ttgaattaga tggtgatgtt aatgggcaca aattttctgt cagtggagag

1441 ggtgaaggtg atgctacata cggaaagctt acccttaaat ttatttgcac tactggaaaa

1501 ctacctgttc catggccaac acttgtcact actttctctt atggtgttca atgcttttcc

1561 cgttatccgg atcatatgaa acggcatgac tttttcaaga gtgccatgcc cgaaggttat

1621 gtacaggaac gcactatatc tttcaaagat gacgggaact acaagacgcg tgctgaagtc

1681 aagtttgaag gtgataccct tgttaatcgt atcgagttaa aaggtattga ttttaaagaa

1741 gatggaaaca ttctcggaca caaactcgag tacaactata actcacacaa tgtatacatc

1801 acggcagaca aacaaaagaa tggaatcaaa gctaacttca aaattcgcca caacattgaa

1861 gatggatccg ttcaactagc agaccattat caacaaaata ctccaattgg cgatggccct

1921 gtccttttac cagacaacca ttacctgtcg acacaatctg ccctttcgaa agatcccaac

1981 gaaaagcgtg accacatggt ccttcttgag tttgtaactg ctgctgggat tacacatggc

2041 atggatgagc tctacaaata atgaattcga gctcggtacc cggggatcct ctagagtcga

2101 cctgcaggca tgcaagcttg gctgttttgg cggatgagag aagattttca gcctgataca

2161 gattaaatca gaacgcagaa gcggtctgat aaaacagaat ttgcctggcg gcagtagcgc

2221 ggtggtccca cctgacccca tgccgaactc agaagtgaaa cgccgtagcg ccgatggtag

2281 tgtggggtcc cccatgcgag agtagggaac tgccaggcat caaataaaac gaaaggctca

2341 gtgcaaagac tgggcctttc gttttatctg ttgtttgtcg gtgaacgctc tcctgagtag

2401 gacaaatccg ccgggagcgg atttgaacgt tgcgaagcaa cggcccggag ggtggcgggc

2461 aggacgcccg ccataaactg ccaggcatca aattaagcag aaggccatcc tgacggatgg

2521 cctttttgcg tttctacaaa ctctttgttt atttttctaa atacattcaa atatgtatcc

2581 gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga agagtatgag

2641 tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc ttcctgtttt

2701 tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt

2761 gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc gccccgaaga

2821 acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat tatcccgtgt

2881 tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg acttggttga

2941 gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag aattatgcag

3001 tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa cgatcggagg

3061 accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc gccttgatcg

3121 ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca cgatgcctgc

3181 agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc tagcttcccg

3241 gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc tgcgctcggc

3301 ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg ggtctcgcgg

3361 tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta tctacacgac

3421 ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag gtgcctcact

3481 gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga ttgatttacg

3541 cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta

3601 cacttgccag cgccctagcg cccgctcctt tcgctttctt cccttccttt ctcgccacgt

3661 tcgccggctt tccccgtcaa gctctaaatc gggggctccc tttagggttc cgatttagtg

3721 ctttacggca cctcgacccc aaaaaacttg atttgggtga tggttcacgt agtgggccat

3781 cgccctgata gacggttttt cgccctttga cgttggagtc cacgttcttt aatagtggac

3841 tcttgttcca aactggaaca acactcaacc ctatctcggg ctattctttt gatttataag

3901 ggattttgcc gatttcggcc tattggttaa aaaatgagct gatttaacaa aaatttaacg

3961 cgaattttaa caaaatatta acgtttacaa tttaaaagga tctaggtgaa gatccttttt

4021 gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc

4081 gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg

4141 caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact

4201 ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg

4261 tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg

4321 ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac

4381 tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca

4441 cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga

4501 gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc

4561 ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct

4621 gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg

4681 agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct

4741 tttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc

4801 tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc

4861 gaggaagcgg aagagcgcct gatgcggtat tttctcctta cgcatctgtg cggtatttca

4921 caccgcatat ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagtat

4981 acactccgct atcgctacgt gactgggtca tggctgcgcc ccgacacccg ccaacacccg

5041 ctgacgcgcc ctgacgggct tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg

5101 tctccgggag ctgcatgtgt cagaggtttt caccgtcatc accgaaacgc gcgaggcagc

5161 aaggagatgg cgcccaacag tcccccggcc acggggcctg ccaccatacc cacgccgaaa

5221 caagcgctca tgagcccgaa gtggcgagcc cgatcttccc catcggtgat gtcggcgata

5281 taggcgccag caaccgcacc tgtggcgccg gtgatgccgg ccacgatgcg tccggcgtag

5341 aggatctaat tctcatgttt gacagcttat c

Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =

Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =

Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =

Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =

Forward 3: 5’ agattagcggatcctacctg 3’ Tm =

Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =

Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =

Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =

Forward 5: 5’ tccataagattagcggatcc 3’ Tm =

Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =

Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=

Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =

Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =

Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =

Forward 8: 5’ctacctgttccatggccaac 3’ Tm=

Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=



Forward 9: 5’ tccataagattagcggatcc 3’ Tm =

Reverse 9: 5’ tctcgcatgggggaccccac 3’Tm =


Share with your friends:


The database is protected by copyright ©dentisty.org 2019
send message

    Main page