In vivo disruption of an Rb-E2f-ezh2 signaling loop causes bladder cancer Mirentxu Santos1, 2



Download 0.82 Mb.
Page3/4
Date conversion08.07.2018
Size0.82 Mb.
1   2   3   4

Supp. Figure S4 Polycomb-bound genes associate with early recurrence in external datasets of bladder cancer.

A) Kaplan-Meier distribution of patients in Lee Dataset (11) according the expression levels of the downregulated genes identified in our study as bound by any PRC2 complex member.

B) Kaplan-Meier distribution of patients in Dyrskjot Dataset (12) according the expression levels of the downregulated genes identified in our study as bound by any PRC2 complex member.

C) Kaplan-Meier distribution of patients in Dyrskjot Dataset (12) according the expression levels of the downregulated genes identified in our study as bound by Ezh2.



p values were obtained by the Log rank test. n denotes the number of samples scored of each group.



Supp. Figure S5 Expression of SUZ12 and EED genes in human NMIBC

A, B) Expression of SUZ12 (A) and EED (B) gene as assessed by RTqPCR (respect to TBP) in normal and tumor samples. p values were obtained by the Mann Whitney t-test, mean and SEM are denoted in red.




Supp. Figure S6 Expression of E2F1, 2 and 3b genes in human NMIBC.

A-B) Expression of E2F1, E2F2 and E2F3b as assessed by RTqPCR (respect to TBP) in normal and tumor samples (A) and in recurrent and non-recurrent tumors (B). p Values were obtained by the Mann Whitney t-test; mean and SEM are shown.

C, E, G). Expression of EZH2 gene as a function of E2F1 (C), E2F2 (E) or E2F3B (G) gene expression as assessed by RTqPCR in NMIBC samples. Spearman correlation coefficients (r) and the corresponding p values are provided.

D, F, H) Kaplan-Meier distribution of recurrence in our patient series according the median of the E2F1 (D), E2F2 (F)or E2F3B (H) gene expression. p values were obtained by the Log rank test. n denotes the number of samples scored of each group.



Supp Table S1 Sequence of the oligonucleotides used in RTqPCR experiments
HUMAN
EZH2 RTsp: 5’-CCTGTCGACATGTTTTGGTC-3’

F 5’- CGGTGTCAAACGCCAATAAA-3’

R 5’- CCGCTCCACTCCACATTCTC-3’
EED RTsp: 5’-TGCTTCCTACAGTTGCAAACAC-3’

F 5’- GAACGCCCTGATACACCTACAAA-3’

R 5´- CATTTTCCCTTCCCCCAACT-3’
SUZ12 RTsp: 5’-CTCTTCTTCCTGGACGAGTCA-3’

F 5’- TCCGATAAGGCAAGTTCCTACAG-3’

R 5’- GAAGTTTCCAGGTTTTGTTTGATTG-3’
E2F1 RTsp: 5’- GTATAAATTAAATGTTTCCA-3’

F: 5’- ACTCAGCCTGGAGCAAGAAC-3’

R: 5’- GAGAAGTCCTCCCGCACAT-3’
E2F2 RTsp: 5’-GAAGTGTCATACCGAGTCTTCTCC-3’

F: 5'-TCC CAA TCC CCT CCA GAT C-3'

R: 5'-CAA GTT GTG CGA TGC CTG C-3’
E2F3A RTsp: 5’-GTTTTTGGACTATCTGGACTTCGTA-3’

F: 5’-TTT AAA CCA TCT GAG AGG TAC TGA TGA-3’

R: 5’-CGG CCC TCC GGC AA-3’
E2F3B RTsp: 5’-GTTTTTGGACTATCTGGACTTCGTA-3’

F: 5’-TTT AAA CCA TCT GAG AGG TAC TGA TGA-3’

R: 5’-CCC TTA CAG CAG CAG GCA A-3’
TBP RTsp: 5’-GTGTTTAAAATCTACATA-3’

F: 5’-AGTGAAGAACAGTCCAGACTG-3’

R: 5’-CCAGGAAATAACTCTGGCTCAT-3’

MOUSE
Ezh2 F: 5’-TGCCTATAATGTACTCTTGGTCG-3’

R: 5’-GCCATCCTGATCCAGAACTTCA-3’


Suz12 F: 5’-AGGCTGCCTCCATTTGAGA-3’

R: 5’-TGGTTTCTCCTGTCCATCG-3’


Eed F: 5’-AGGAGACCCTCTGGTGTTTG-3’

R: 5’-AGGACTGCAATAACCGTATCTCC-3’


E2f1 F: 5’-CTGCAGCAACTGCAGGAGAG-3’

R: 5’-CTCCGAAAGCAGTTGCAGC-3’


E2f2 F: 5’-GGC TTC CCC AGT CTT TTT GAT-3’

R: 5’-TGT GAG CTT GTT CCC ACG CTA-3’


E2f3a F: 5’-GCCTCTACACCACGCCACAAG-3’

R: 5’-CCTTCCAGCACGTTGGTGAT-3’


E2f3b F: 5’-CGGAAATGCCCTTACAGC-3’

R: 5’-CCTTCCAGCACGTTGGTGAT-3’


Rb1 F: 5’- CACGTGTAA ATTCTGCTGCAA -3’

R: 5’- ACAGGGCAAGGGAGGTAGAT -3’


Rbl2 F: 5’- AAGGCACATGCTAACCAATGAA -3’

R: 5’- GAGCAGTTACCGCAGCATGA -3’


Tbp F: 5’-GGGAGAATCATGGACCAGAA-3’

R: 5’-GATGGGAATTCCAGGAGTCA-3’




Supp Table S7 GSEA of Genes Deregulated in mouse bladder tumors

NAME

SIZE

ES

NES

NOM p-val

FDR q-val

LINDGREN_BLADDER_CANCER_CLUSTER_2B

328

-0.5206547

-2.5106754

<10E-4

<10E-4

LINDGREN_BLADDER_CANCER_HIGH_RECURRENCE

43

-0.6479887

-2.2641902

<10E-4

1.90E-05

WU_SILENCED_BY_METHYLATION_IN_BLADDER_CANCER

49

-0.50014836

-1.8062401

<10E-4

0.01233348

WONG_ADULT_TISSUE_STEM_MODULE

650

-0.46094787

-2.380974

<10E-4

<10E-4

RAMALHO_STEMNESS_DN

63

-0.43469974

-1.6982198

<10E-4

0.02642152

MIKKELSEN_ES_ICP_WITH_H3K4ME3_AND_H3K27ME3

123

-0.3614386

-1.5463258

<10E-4

0.06257117

BENPORATH_ES_WITH_H3K27ME3

960

-0.39613822

-2.049046

<10E-4

0.00103196

LINDGREN_BLADDER_CANCER_CLUSTER_2A_DN

112

-0.36527905

-1.5493951

0.00404858

0.06209189

LINDGREN_BLADDER_CANCER_CLUSTER_3_DN

189

-0.29670364

-1.3459696

0.00492611

0.14766957

LINDGREN_BLADDER_CANCER_CLUSTER_3_UP

271

0.70151365

2.8543577

<10E-4

<10E-4

LINDGREN_BLADDER_CANCER_CLUSTER_1_DN

329

0.61487466

2.5550387

<10E-4

<10E-4

KONG_E2F3_TARGETS

84

0.898975

3.1666567

<10E-4

<10E-4

ISHIDA_E2F_TARGETS

47

0.95764613

3.1021447

<10E-4

<10E-4

REN_BOUND_BY_E2F

55

0.89197963

2.9354384

<10E-4

<10E-4

BENPORATH_ES_1

324

0.5924173

2.4529488

<10E-4

<10E-4

WONG_EMBRYONIC_STEM_CELL_CORE

304

0.68066955

2.812623

<10E-4

<10E-4

BENPORATH_ES_2

36

0.6848525

2.079576

<10E-4

5.15E-05

OSMAN_BLADDER_CANCER_UP

344

0.37513605

1.5703176

0.00116686

0.03824369

KEGG_BLADDER_CANCER

36

0.5016914

1.5490465

0.01367781

0.04412836

RAMALHO_STEMNESS_UP

188

0.33850253

1.3295037

0.02798982

0.16199867

CONRAD_STEM_CELL

37

0.4782928

1.4603794

0.04281345

0.07987016

LINDGREN_BLADDER_CANCER_WITH_LOH_IN_CHR9Q

90

0.37484476

1.3256984

0.06536857

0.1652244

NES: normalized enrichment score.




NES <0: enrichment in normal mouse bladder




NES>0: enrichment in mouse bladder tumors




FDR: False discovery rate.




SIZE: Number of genes within each gene set




Supp Table S8 Comparative transcriptome studies in Oncomine Database of genes downregulated in mouse bladder tumors


Genes Downregulated in mouse bladder tumors
















Analysis Type:

Cancer vs. Normal Analysis



















Concept Name

Overlap

P-Value

Q-Value

Odds Ratio

Dataset




Infiltrating Bladder Urothelial Carcinoma vs. Normal - Top 10% Under-expressed (Sanchez-Carbayo Bladder 2)

128

1.80E-21

7.23E-18

3

Sanchez-Carbayo Bladder 2




Superficial Bladder Cancer vs. Normal - Top 10% Under-expressed (Sanchez-Carbayo Bladder 2)

119

2.41E-17

4.47E-14

2.7

Sanchez-Carbayo Bladder 2




Superficial Bladder Cancer vs. Normal - Top 10% Under-expressed (Lee Bladder)

140

3.96E-15

4.50E-12

2.3

Lee Bladder




Infiltrating Bladder Urothelial Carcinoma vs. Normal - Top 10% Under-expressed (Lee Bladder)

124

7.00E-10

2.96E-07

1.9

Lee Bladder




Infiltrating Bladder Urothelial Carcinoma vs. Normal - Top 5% Under-expressed (Blaveri Bladder 2)

29

2.36E-05

0.003

2.6

Blaveri Bladder 2




Superficial Bladder Cancer vs. Normal - Top 10% Under-expressed (Blaveri Bladder 2)

42

7.64E-04

0.042

1.8

Blaveri Bladder 2




Infiltrating Bladder Urothelial Carcinoma vs. Normal - Top 10% Under-expressed (Dyrskjot Bladder 3)

73

0.004

0.139

1.4

Dyrskjot Bladder 3






















Analysis Type:

Clinical Outcome Analysis



















Concept Name

Overlap

P-Value

Q-Value

Odds Ratio

Dataset




Infiltrating Bladder Urothelial Carcinoma - Dead at 3 Years - Top 10% Under-expressed (Lee Bladder)

136

1.02E-13

8.66E-11

2.2

Lee Bladder




Infiltrating Bladder Urothelial Carcinoma - Dead at 1 Year - Top 5% Under-expressed (Lee Bladder)

72

1.32E-08

4.31E-06

2.2

Lee Bladder




Infiltrating Bladder Urothelial Carcinoma - Dead at 5 Years - Top 10% Under-expressed (Lee Bladder)

112

1.12E-06

2.09E-04

1.7

Lee Bladder






















Analysis Type:

Mutation Analysis



















Concept Name

Overlap

P-Value

Q-Value

Odds Ratio

Dataset




Multi-cancer Cell Line - KRAS Mutation - Top 10% Under-expressed (Garnett CellLine)

93

8.83E-08

2.28E-05

1.9

Garnett CellLine




Multi-cancer Cell Line - KDM6A Mutation - Top 5% Under-expressed (Garnett CellLine)

44

9.34E-04

0.049

1.7

Garnett CellLine






















Analysis Type:

Drug Sensitivity Analysis



















Concept Name

Overlap

P-Value

Q-Value

Odds Ratio

Dataset




NVP-TAE684 Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Barretina CellLine)

151

1.32E-18

3.10E-15

2.5

Barretina CellLine




Vandetanib Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Barretina CellLine)

143

1.42E-15

1.80E-12

2.3

Barretina CellLine




Saracatinib Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Barretina CellLine)

131

1.66E-11

9.55E-09

2

Barretina CellLine




Irinotecan Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Barretina CellLine)

126

5.49E-10

2.39E-07

1.9

Barretina CellLine




Topotecan Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Barretina CellLine)

125

1.07E-09

4.31E-07

1.9

Barretina CellLine




Sorafenib Sensitive - Multi-cancer Cell Line - Top 5% Under-expressed (Barretina CellLine)

66

2.27E-06

3.83E-04

2

Barretina CellLine




Metformin Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Garnett CellLine)

86

7.46E-06

0.001

1.8

Garnett CellLine




Bleomycin Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Garnett CellLine)

83

4.05E-05

0.004

1.7

Garnett CellLine




GSK1070916 Sensitive - Bladder Cancer Cell Line - Top 10% Under-expressed (Wooster CellLine)

105

8.13E-05

0.008

1.5

Wooster CellLine




Mitomycin Sensitive - Multi-cancer Cell Line - Top 1% Under-expressed (Garnett CellLine)

16

9.18E-05

0.008

3.3

Garnett CellLine




PD0325901 Sensitive - Multi-cancer Cell Line - Top 1% Under-expressed (Garnett CellLine)

16

9.18E-05

0.008

3.3

Garnett CellLine




BI-D1870 Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Garnett CellLine)

81

1.17E-04

0.01

1.6

Garnett CellLine




Dovitinib Lactate Sensitive - Multi-cancer Cell Line - Top 5% Under-expressed (Barretina CellLine)

58

3.33E-04

0.022

1.7

Barretina CellLine




NVP-AEW541 Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Barretina CellLine)

101

4.60E-04

0.028

1.5

Barretina CellLine




Paclitaxel Sensitive - Bladder Cancer Cell Line - Top 10% Under-expressed (Lee CellLine 2)

78

5.10E-04

0.031

1.6

Lee CellLine 2




Tanespimycin Sensitive - Multi-cancer Cell Line - Top 5% Under-expressed (Barretina CellLine)

57

5.72E-04

0.033

1.6

Barretina CellLine




PD-0332991 Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Garnett CellLine)

76

0.001

0.059

1.5

Garnett CellLine




JNK-9L Sensitive - Multi-cancer Cell Line - Top 5% Under-expressed (Garnett CellLine)

40

0.008

0.2

1.6

Garnett CellLine




Cytarabine Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Garnett CellLine)

71

0.009

0.216

1.4

Garnett CellLine




Temsirolimus Sensitive - Multi-cancer Cell Line - Top 10% Under-expressed (Garnett CellLine)

71

0.009

0.216

1.4

Garnett CellLine











































Literature-defined Concepts

Concept Name

Overlap

P-Value

Q-Value

Odds Ratio




Downregulated in Human Embryonic Stem Cells vs Differentiated Counterparts

61

6.34E-16

8.75E-13

3.7




Trimethylated H3K27 target genes in human embryonic stem cells

63

1.03E-15

1.38E-12

3.5




SUZ12 target genes in human embryonic stem cells

58

2.22E-14

2.15E-11

3.5




Trimethylated H3K27 target genes in human embryonic fibroblasts

96

5.50E-14

4.96E-11

2.5




EED target genes in human embryonic fibroblasts

52

6.75E-11

3.47E-08

3




Polycomb Group target genes in human embryonic stem cells

36

2.85E-09

1.08E-06

3.4




SUZ12 target genes in human embryonic fibroblasts

49

3.78E-09

1.40E-06

2.7




Upregulated in Human Embryonic Stem Cells vs Differentiated Counterparts

42

6.49E-09

2.23E-06

2.9




Downregulated genes in U2OS cells upon E2F3 expression

17

5.95E-07

1.17E-04

4.7




Hypermethylated genes in cancer

21

2.01E-06

3.46E-04

3.5




Downregulated genes in U2OS cells upon E2F2 expression

7

6.91E-04

0.038

5.1




Activated upon Polycomb Group knockdown

14

0.002

0.096

2.5




Upregulated genes in G1 arrested osteosarcoma cells expressing E2F1

4

0.01

0.217

5.2


1   2   3   4


The database is protected by copyright ©dentisty.org 2016
send message

    Main page