3’ 5'-aggttggcttggtttgcaatcatc-3'



Download 39 Kb.
Date06.02.2017
Size39 Kb.
The restriction enzyme HaeII cuts or cleaves DNA at the GGCC sequence. If the individual has that sequence the restriction enzyme will cleave the gene at that locality. Non tasters do not show this sequence and so in this 221 base pair region of the DNA, the segment stays whole. If a classmate was a taster, their DNA would be cleaved leaving a 44 and 177 base pair segment, which would be able to be seen through gel electrophoresis. What would be seen specifically in gel electrophoresis is a single stand for non tasters, and two split segments for those with the ability to taste bitter (the PTC paper)
Note that the actual SNP on either allele is either a G or a C. If a C was present at postion 145 on both alleles, the genotype is predicted to be TT,  If a G was present on both of the student's alleles, they are designated a tt, for predicted nontaster. If a G was found on one allele and a C was found on the other allele, the students indicate that they are heterozygous, or Tt, or which is associated with a weak ability to taste PTC.
5726 TAS2R38- Taster

GCTTTGGGATAGATCTAGGCAAAGAGCTGGATGCTTTGTGAAGGAAAGGTCCTGGCTTGGAACGTACATTTACCTTTCTGCACTGGGTGGCAACCAGGTCTTTAGATTAGCCAACTAGAGAAGAGAAGTAGAATAGCCAATTAGAGAAGTGACATCATGTTGACTCTAACTCGCATCCGCACTGTGTCCTATGAAGTCAGGAGTACATTTCTGTTCATTTCAGTCCTGGAGTTTGCAGTGGGGTTTCTGACCAATGCCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCCGGCACTGAGCAACAGTGATTGTGTGCTGCTGTGTCTCAGCATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCCTGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTGAACCACTGAACCACAGCTACCAAGCCATCATCATGCTATGGATGATTGCAAACCAAGCCAACCTCTGGCTTGCTGCCTGCCTCAGCCTGCTTTACTGCTCCAAGCTCATCCGTTTCTCTCACACCTTCCTGATCTGCTTGGCAAGCTGGGTCTCCAGGAAGATCTCCCAGATGCTCCTGGGTATTATTC

Primer Sequence:

            5'-CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG-3’


            5'-AGGTTGGCTTGGTTTGCAATCATC-3'

Go to the National Center for Biotechnology Information (NCBI) website,



http://www.ncbi.nlm.nih.gov/


  1. Select BLAST on the top menu bar of the home page.

  2. Under Basic BLAST, clicked nucleotide BLAST.

  3. Past the sequence of the primers into the search window (excluding "5'- and -3'").
    Switch the "Choose Search Set" dropdown menu to "Nucleotide collection (nr/nt)
    Under program selection selecte the radio button labeled "Somewhat similar sequences (blastn)."

  4. Click ‘Blast

The information is split into three sections; Graphic Summary, Descriptions, and Alignments.

In the allignments section the primer sequence is aligned to the nucleotide sequence that was hit in the search.  Notice that 43 of the forward primer is missing, this is because the nucleotide did not match the sequence. Also In the Alignments section each alignment has an E-value The E-value is the number of alignments that would be expected by chance, the lower the E-value the higher the probability is that the hit is a close match to the query.  For example an E-value of 6e-12 means that this is a strong match from the database.  In the Descriptions section there are many significant alignments that have E-values less than 0.1, they belong to humans and other primates with the bitter taster receptor TAS2R38.  Also notice the sequence numbers on the bottom of the seqeunces highlited by the green arrows this is where the primers have landed on the subject sequence.
In the alignments section click on the PTC Taster (ref|NM_176817.3|)
The top of the page contains information about the sequence, such as basepair length, database accession number, source, and references.  The middle of the report there are annotations of gene and regulatory features.  The bottom section has the entire nucleotide sequence of the DNA sequence that contains the PCR product,
List the title of two studies linked to this nucleotide sequence
Return to the NCBI home page and clicked on "mapviewer." 

In the table find Homo sapiens  and click on the B icon next to the build with the highest number


Enter the primer sequences into the search window, except for the non-nucleotide letters.  Selected BLASTN from the drop-down menu then clicked "Begin Search"


  1. Then clicked "View Report"

  2. Next clicked "Human genome view"

  3. Notice this sequence is located on chromosome seven. 

    Click on chromosome seven to go to the TAS2R38 locus,



The view can be adjusted to zoom out/in or move up/down the chromosomes to look at neighboring genes.  The genes found on either side of TAS2R38 are CLECF5S (a lectin domain gene) and MGAM (a gene that encodes for a starch digesting enzyme).  These genes have multiple coding exons while TAS2R38 has only one coding exon.  Most of the genes in this area are mostly taste and olfactory receptors.
Go to NCBI Home page

In the dropdown search menu select ‘HomoloGene


What does this data base allow you to search?
Search the HomoloGene data base for the PTC Gene: 5726 TAS2R38
Scroll down to the protein Alignment section

Click on Show Pairwise Alignment Scores




  1. List the percentage of similarity between the Human version of 5726 TAS2R38 and the other mammals listed.

  2. To compare the Human and Chimpanzee protein sequences click on “Blast” on the right side of the data table.




  1. How many proteins differences are there between humans and chimpanzees?

  2. Repeat this same calculation for Humans and Bos Taurus, domestic cow

  3. and Mus musculusm the common house mouse.




  1. Explain why the this pattern of similarity exits for these 3 mammals.






Share with your friends:


The database is protected by copyright ©dentisty.org 2019
send message

    Main page